Answer:
TTppRR will produce TpR gametes. ttPPrr will produce tPr gametes.
Explanation:
Let us assume:
Normal tail : T, Tail less : t, Pale skin : P, Dark skin : p, Smooth skin : R, Rough skin : r
A pure-bred normal tail, dark skin, smooth skin mouse and a pure-bred mouse that is tail-less, pale skin, and rough skin crossed together then,
TTppRR x ttPPrr
One allele from every gene comes in a gamete thus, TTppRR will produce TpR gametes. ttPPrr will produce tPr gametes.
The accurate statements to the signal transduction pathways are as follows:
1. A receptor changes conformation upon attachment, conducting a signal across the cell membrane.
2. A second messenger may carry a signal from the cell membrane to an organelle.
3. Signal transduction cascades, often involving protein kinases, amplify a signal intracellularly.
4. A receptor may pass on a signal by associating with another protein or by functioning as an enzyme.
5. A ligand, like hormone, combines with a specific cell surface receptor on a target cell.
6. Phosphatase eradicate phosphoryl groups from polypeptides, monitoring the response of the cell.
The hypothesis by Coleman was that the product of the ob+ gene was the appetite suppressing hormone. Hence, the homozygous ob/ob mutant are in a position to synthesize that hormone, and its circulating level would be zero. He also hypothesized that the product of the db+ gene was the receptor for the appetite-suppressing hormone. Thus, the homozygous db/db mutant would be able to synthesize the hormone but would not be in a position to respond to it. It would eat excessively and produce large amounts of body fat, which in turn would produce large amounts of appetite-suppressing hormone . In the absence of a receptor, the db/db mutant's hormone level would remain abnormally high.
Coleman's hypothesis were confirmed when the precise functions of the ob+ and db+ genes were determined. The peptide hormone encoded by the ob+ gene was named Leptin.
Answer:
After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is
Explanation:
1. AACGTACGATCGATGCACATGCATGGCTACGC
Complementary strand
TTGCATGCTAGCTACGTGTACGTACCGATGCG
Protein encode: NVRSMHMHGY
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
Complementary strand
GGGCCCATACGTACATGCATGCAGCATATAGC
Protein encode: PGYACTYVVY
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
Complementary strand
GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA
Protein encode: RDRAIDECLV
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
Complementary strand
AATTTGCTCGACGATCGATAAAAATTTTGGGGC
Protein encode: LNELLAIFKTP
Ponds and Lake Ponds and Lakes form when water collects in<span> hollows and low-lying areas of land. </span>
