1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aivan3 [116]
3 years ago
11

Name the subatomic particle that participates in chemical bond formation?

Biology
1 answer:
Natalka [10]3 years ago
4 0
A type of strong chemical bond in which two atoms share one or more pairs of valence electrons. Two or more atoms held together by covalent bonds. The attraction that exists between opposing (positive and negative) charges within the atom.
You might be interested in
Two diseases resulting from hyperfunction of the pituitary gland are:
Snezhnost [94]
Gigantism and acromegaly are the two diseases resulting from hyper function of the pituitary gland. Gigantism and acromegaly are conditions that are nearly always due to a pituitary adenoma that is because of excessive secretion of a growth hormone called hypersomatotropism. <span>If GH hypersecretion begins in childhood, before closure of the epiphyses pituitary gigantism occurs. It is a rare condition where skeletal growth velocity and ultimate stature are increased, but little bony deformity occurs. However, soft-tissue swelling occurs, and the peripheral nerves are enlarged. Hypogonadotropic hypogonadism and deferred puberty is also normally present, resulting in a eunuchoid habitus. While Acromegaly occurs after the growth plate cartilage fuses in adulthood, it is the same disorder of IGF-I excess but in acromegaly, an unadorned disease that morbidity and mortality rates are high because its often diagnosed late, where the disease is associated with cardiovascular, cerebrovascular, and respiratory disorders and malignancies. </span>



7 0
3 years ago
Which characteristic do euglenoids and algae share
Svetradugi [14.3K]
Euglenoids <span>are unicellular protists commonly found in fresh </span>water.They don not have a cell<span> wall, despite that, a protein rich </span>cell membrane called pellicle is present in Euglenoids.
Whereas,<span>Algae are eukaryotic organisms comprising of no roots, stems, or leaves but they filled with chlorophyll and other pigments to carry out the process of photosynthesis. Similar to </span>Euglenoids, they<span> occur most frequently in water, specifically in plankton.
</span>Hence,
Euglenoids and algae share a common characteristic,that is both are autotrophs. They <span>produce complex organic compounds from simple substances present in their surroundings, by the use of energy from sun-light or inorganic chemical reactions.</span>
6 0
3 years ago
Read 2 more answers
6/9 in decimal. <br><br><br><br> please help 100 points
vekshin1

Answer:

.66666666667

6 continues to repeat.

fraction can be reduced to 2/3

Use calculator or write out long hand

8 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
In Guinea pigs, short hair is dominant and long hair is recessive. A
larisa86 [58]

Answer:

a. S represents allele for short hair while s represents allele for long hair.

b. Ss (male) × ss (female)

c. 50% Ss, 50% ss

d. 3 long hair (ss), 3 short hair (Ss)

Explanation:

This question involves a single gene coding for hair length in guinea pigs. The allele for short hair (S) is dominant over the allele for long hair (s).

a. Letter "S" will represent the allele for short hair while letter "s" will represent the allele for long hair.

b. According to this question, a heterozygous male is crossed with a long-haired female. The genotype of the male guinea pig is "Ss" while that of the female is "ss". (see attachment for the punnet square)

c. The possible genotypes of the offsprings in this cross are: Ss and ss, each carrying 50% each as they are produced in a ½ Ss: ½ ss.

d. Since 50% of the offsprings will be both short haired and long haired, If they have six babies, 3 of them will be short-haired while 3 of them will also be long-haired.

7 0
2 years ago
Other questions:
  • Which classes of wave is descriptive of sound? Longitudinal waves or Transverse waves?
    7·1 answer
  • Number 5 !!!!! Please help I'll appreciate it !!!!
    5·2 answers
  • Rickettsia are obligate intracellular parasites that are transmitted by arthropods. In which of the following places would you m
    11·1 answer
  • Porque os mamíferos tiveram tanto sucesso evolutivo?
    8·1 answer
  • The expected remaining lifespan of the sun is thought to be about how many years ?
    7·1 answer
  • Vascular plants help maintain the water cycle. which property ot these plants enables them to carry out this function?
    7·1 answer
  • Match the description below with the correct biological group it represents.
    7·1 answer
  • What are some services give me like 5 .
    7·2 answers
  • Most carbon dioxide is carried from the body tissues to the lungs _____.
    15·1 answer
  • A melotic division produces ____ daughters cells?<br> 4<br> 2<br> 1
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!