1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zavuch27 [327]
3 years ago
14

Which of these will help you keep the information from your notes fresh in your mind?

Biology
1 answer:
olganol [36]3 years ago
8 0
Hello

Reviewing over by memorizing them
Flash cards
Quizlet
Kahoot!

These are different way to study

Hope this helps
Plz mark me as brainist
You might be interested in
A region experiences frequent landslides from heavy rains. How can the local residents lower the frequency of landslides in the
german
In order for the local residents to lower the frequency of landslides in the region that experiences frequent landslides from heavy rains, they should do the following:
A. Start contour plowing on the slopes where landslides happen.
B. Plant vegetation on the slopes that experience landslides.
6 0
3 years ago
Onion root tips are often used to study mitosis because they grow very rapidly, which means that many cells are dividing. The ve
guajiro [1.7K]

Answer:

- Dependent variable: number of cells that are in one of the phases of mitosis

Explanation:

In an experiment, the independent variable is the variable that is not changed by the other variables that are being measured during the experiment (in this case, the independent variable is represented by the distances from the root cap). On the other hand, the dependent variable is the variable that is being measured/tested during the experimental procedure and, therefore, is 'dependent' on the independent variable. In consequence, in an experiment, the dependent variable is expected to change as a result of the manipulation of the independent variable.

7 0
3 years ago
Define acidity. How is it measured?
Aleksandr [31]

Answer:

its the level of acid in substances

you put the amount of a item into a cup and add water.

Explanation:

4 0
3 years ago
Can anyone help me please
brilliants [131]

Answer:

a - flower

b - ovule

c - fruit

d - embryo

e - seed

f - seedling

Explanation:

4 0
3 years ago
Dialysis tubing is permeable to water molecules but not too sucrose. Three dialysis tubes are filled with various solutions and
almond37 [142]

Answer:

tube 3

Explanation:

because it contains pure water

7 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The fortification of salt with iodine in the united states has dramatically reduced the incidence of _______________. osteoporos
    8·1 answer
  • These are The questions need help on numbers 1-6 please use The passage picture To help answer The questions
    5·1 answer
  • explain the how protein contained in seeds or milk is useful for the plant sprouting from the seed or the baby mammal
    10·2 answers
  • A. What gases were present in Earth's early atmosphere?
    14·1 answer
  • •¿POR QUÉ CREES QUE ES IMPORTANTE LA BIODIVERSIDAD?
    6·1 answer
  • A Topographic map would be most useful for which activity
    5·1 answer
  • How many pairs of chromosomes does a human have in their liver cells
    11·1 answer
  • Which was not a result of the 1898 discovery of the four blood types and advances made during the two World Wars? improved blood
    7·2 answers
  • A medical researcher finds a strain of bacteria that has cause infections in several patients. At time 0 hours, the researcher p
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!