1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AlladinOne [14]
3 years ago
15

An employee is entitled by law to reasonably safe working conditions. True O False

Law
2 answers:
VMariaS [17]3 years ago
3 0

Answer:

true

Explanation:

nobody would put another person at risk

zloy xaker [14]3 years ago
3 0
True because everyone should be able to have a safe and clean working environment
You might be interested in
Name some poetic device used in my mother at sixty six by Kamala Das. 1970 ​
allsm [11]
Following poetic devices have been used in the poem My Mother at Sixty Six.

Simile: it is the comparison of two things by using as or like. e.g. “her face ashen like that of a corpse”, “as a late winter’s moon”.
Metaphor: it is the direct comparison of two things without the use of as or like. e.g. “the merry children spilling”.
Personification: When we give human characteristics to animals or plants or non-living things. e.g. “trees sprinting”.
Anaphora: It is the repetition of a word or phrase to create a poetic effect in a poem. e.g. the poet repeats these words, “smile and smile and smile”.
Alliteration: It is the repetition of the consonant sounds in a line of a poem. e.g. “my mother”, “that thought”, “I said was, see you soon”.
3 0
2 years ago
What in jrotc does Integrity mean?
Evgesh-ka [11]

Answer:

To do whats right, legally and morally.

Explanation:

Mark bRainliest

8 0
3 years ago
Please help me out with this one!
jasenka [17]

A, because it clearly describes the separation of powers between the branches of government

7 0
3 years ago
Complete each sentence using the drop-down menu.
den301095 [7]

Answer:

The Democratic Party

The Republican Party

The Green Party

Libertarians

Al Gore or electoral college one of those

Explanation:

8 0
3 years ago
Read 2 more answers
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • "Tom and Jim are neighbors. Jim wants to buy Tom’s rental property. In the contract they sign, Jim is identified only as "the ne
    12·1 answer
  • How many delegates were at the constitutional convention?
    13·1 answer
  • What is the effectiveness of canada’s roll in the european union?
    12·1 answer
  • This was a law created in 1887 to regulate railroads to ensure fair rates
    6·1 answer
  • What is a Good Samaritan policy in relation to alcohol abuse
    12·1 answer
  • write a paragraph of how the impact that the repeal of the fairness doctrine has had on our news coverage / our political system
    12·1 answer
  • Chủ nghĩa Mác-Lênin khẳng định: "Một cuộc cách mạng chỉ có giá trị khi nào nó biết tự bảo vệ và bảo vệ tổ quốc XHCN là một tất y
    12·1 answer
  • 'Victimhood is not an objective assessment of harm
    15·1 answer
  • List all of the areas in which Article 1 section 8 of the US Constitution provides for federal employment and the spending of fe
    5·2 answers
  • Which statement best describes a scientific law?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!