Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
The color of the vegetation in a sketch of a map is green.
Explanation:
The maps use several different methods to depict the geographic space and its characteristics in the best possible manner to the reader of the map. One of those methods is the use of colors. The colors are put on maps in accordance with what they associate the people the most when it comes to geography and the environment.
When it comes to depicting the vegetation, the color that is found on the maps is green. This has several reasons as to why it is so. The green color is most often associated with nature, with plants, greenery if you will, so it is the primary color that people associate with vegetation. Even though not all plants are green, like the bark of the trees for example can be dark or light brown, ashy, greyish, reddish, and there are grasses, shrubs, and flowers in every color, one thing that the majority of them have in comon is green leaves and stems, which are the ones that are the most striking to the human eye.
