1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Travka [436]
4 years ago
8

What are the different types of ecosystems?

Biology
1 answer:
densk [106]4 years ago
3 0
An ecosystem consists of all the living and non-living things in a specific natural setting. Plants, animals, insects, microorganisms, rocks, soil, water and sunlight are major components of many ecosystems. All types of ecosystems fall into one of two categories: terrestrial or aquatic.
Hope it could help : )
You might be interested in
What can you conclude from the fact that more than a billion species have gone extinct during Earth's history?
MArishka [77]
A. Extinction is a natural part of life on earth
8 0
3 years ago
Where are Peyer's patches found?
PolarNik [594]

Answer:

Option (B).

Explanation:

Peyer's patches are the small masses of aggregated small lymphatic tissues and provide immunity to an organism. Peyer patches are discovered by the scientiest Johannan Cornard Peyer.

Peyer's patches are located in the ileum region of small intestine. These patches control the growth of harmful bacteria and regulates the growth of intestine bacteria. T

Thus, the correct answer is option (B).

7 0
3 years ago
A particular antigen is known to have 6 different antigenic determination sites (epitopes).
charle [14.2K]

Six distinct antibody subtypes can be produced in response to the antigen.

It is assumed that a certain antigen has six distinct antigenic determination sites.

To find out how many various types of antibodies this antigen can trigger production of, read on.

A molecule, chemical structure, foreign particle, pollen grain, or any other substance that can attach to a particular antibody or T-cell receptor is referred to as an antigen.

An epitope is an antigenic determinant, which is the component of an antigen that the immune system recognizes.

An antibody is a large, Y-shaped protein that the immune system employs to recognize and destroy foreign substances like dangerous germs and viruses.

Learn more about antigen click here brainly.com/question/15694610

#SPJ1

4 0
2 years ago
Why are stars and solar systems separated in the diagram below?
shepuryov [24]
Because they are in different galaxies. I hope this helps! :)
5 0
3 years ago
Which best defines carrying capacity
blsea [12.9K]
The carrying capacity of a biological species in an environment is the maximum population size of the species that the environment can sustain indefinitely, given the food, habitat, water, and other necessities available in the environment.
3 0
3 years ago
Other questions:
  • Read the excerpt from Sir Gawain and the Green Knight. Gawain, sitting next to the Queen, Bowed to the King then: "I will keep m
    13·2 answers
  • according to the theory of evolution, birds feathers evolved from: a) reptiles scales b) fish fins c) gill slits d) gill arches
    9·1 answer
  • Soils vary throughout the world because _____.
    9·2 answers
  • Dogs and cats are animals that have many similar body structures but they do not mate with each other. These two animals are cla
    7·1 answer
  • Plants need bacteria in order to take up and use which element?
    12·1 answer
  • Create your own hypothesis and state the dependent and independent variable.
    8·1 answer
  • I lived on a small indonesian island around 18 kya. i used stone tools to hunt animals, but i had a very small cranial capacity
    8·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Please help! In which type of ecosystem would fire most likely be a limiting factor for plant species?
    11·2 answers
  • What are 2 non-example of potential energy ?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!