1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Travka [436]
3 years ago
8

What are the different types of ecosystems?

Biology
1 answer:
densk [106]3 years ago
3 0
An ecosystem consists of all the living and non-living things in a specific natural setting. Plants, animals, insects, microorganisms, rocks, soil, water and sunlight are major components of many ecosystems. All types of ecosystems fall into one of two categories: terrestrial or aquatic.
Hope it could help : )
You might be interested in
Ferns tend to live in which of the following habitats?"
lorasvet [3.4K]

Answer:

Moist and shaddy

Explanation:

3 0
3 years ago
Read 2 more answers
Which product of photosynthesis is released from leaves as a gas?
uranmaximum [27]
Oxygen, it takes in Carbon Dioxide and releases Oxygen as a waste :)
8 0
3 years ago
Which characteristic do gnetophytes and cycads have in common? are all deciduous may grow in tropical climates grow as vines are
jonny [76]

Answer AND Explanation:

Gnetophytes are gymnosperms , they are woody  and the embryo has two cotyledons . Cycads are woody plants that produce seeds found in Subtropical and warm temperate regions and also they produce motile sperm cells.

4 0
4 years ago
PLEASE HELP ME <br> What are the steps to photosynthesis
RoseWind [281]

Explanation:

During photosynthesis, molecules in leaves capture sunlight and energize electrons, which are then stored in the covalent bonds of carbohydrate molecules. That energy within those covalent bonds will be released when they are broken during cell respiration. How long lasting and stable are those covalent bonds? The energy extracted today by the burning of coal and petroleum products represents sunlight energy captured and stored by photosynthesis almost 200 million years ago.

Plants, algae, and a group of bacteria called cyanobacteria are the only organisms capable of performing photosynthesis. Because they use light to manufacture their own food, they are called photoautotrophs (“self-feeders using light”). Other organisms, such as animals, fungi, and most other bacteria, are termed heterotrophs (“other feeders”) because they must rely on the sugars produced by photosynthetic organisms for their energy needs. A third very interesting group of bacteria synthesize sugars, not by using sunlight’s energy, but by extracting energy from inorganic chemical compounds; hence, they are referred to as chemoautotrophs.

6 0
3 years ago
Read 2 more answers
9(5x + 1) ÷ 3y
juin [17]

Answer:

\frac{9(5x + 1)}{3y}  \\  =  \frac{3(5x + 1)}{y}  \\  =  \frac{15x + 3}{y}

3 0
3 years ago
Other questions:
  • Explain how you can tell the sex of a person by looking at that person’s karyotype.
    14·1 answer
  • In order for a cell to decide successfully, the cell must first?
    7·1 answer
  • 3. Explain the role of a hypothesis in a scientific investigation.
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • A run chart can help with which two steps of the quality process
    7·1 answer
  • Why would competition be considered a limiting factor within an ecosystem?
    8·1 answer
  • Particle with the symbol -?
    6·1 answer
  • 2. give a specific example of when increased range of motion would be beneficial in<br> a sport
    7·2 answers
  • Fossils can usually be found in layers of
    9·2 answers
  • In a population of cattle, the average body fat percentage is 10.5%. You select parents with an average body weight percentage o
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!