1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yarga [219]
4 years ago
11

As responsible citizens, people should follow certain practices that lower the emission of greenhouse gases. They should also av

oid activities that raise the levels of greenhouse gases. Sort the activities into those people should do and those they should avoid.
Leave appliances turned on after using them.

Take a bus instead of driving a car.

Recycle used items.

Boil a full kettle of water to make one cup of tea.

Use solar energy to heat water.

Compost kitchen waste.
Biology
2 answers:
Sedbober [7]4 years ago
6 0

Do this:

take a bus

recycle used items

compost kitchen waste

use solar energy to heat water

Avoid this

leave appliance turned on after using them

Boil a full kettle for one cup of tea

frutty [35]4 years ago
5 0
Activities people should do include:
1. Recycle used items
2. Use solar energy to heat water
3.Compost kitchen wastes.
4.Take a bus instead of driving a car.
These activities do not involve burning, so they avoid adding to the level of green house gases already in existence.
Activities people should avoid include:
1.leaving appliances turned on after using them
2. Boiling a full kettle of water to make one cup of tea
These activities add to the level of greenhouse gases that are already in existence.
You might be interested in
9 . Our ability to make our legs move as we walk across the room is controlled by the ________ nervous system.
klasskru [66]

The SNS carries information to control movements of the muscles of the body.

<h3>What is somatic nervous system?</h3>

It is a part of the Peripheral Nervous System that is responsible for transmitting both sensory information and the muscles.

It is related to the innervation of skeletal muscle by motor axons that conduct impulses to skeletal muscles, to allow movements such as walking.

Therefore, we can conclude that the somatic nervous system is responsible for sending motor control information to skeletal muscles.

Learn more about SNS here: brainly.com/question/8695732

3 0
2 years ago
True or false. Every living organism on Earth has been classified.
Ipatiy [6.2K]

Answer:

False

Explanation:

         We know more of the moon than we do of our own oceans! There are many, <em>many</em>, organisms on Earth that have not been classified. We have not been able to explore deep in the ocean, extremely cold climates, and some may have even been missed in "our backyard" because Earth is so diverse! According to <em>National Geographic</em>, "Even after centuries of effort, some 86 percent of Earth's species have yet to be fully described, according to new study that predicts our planet is home to 8.7 million species. ... So far, some 1.2 million species are known to science."

Have a nice day!

     I hope this is what you are looking for, but if not - comment! I will edit and update my answer accordingly. (ノ^∇^)

- Heather

5 0
3 years ago
Which of the following chemical equations describes a hydrolysis reaction? Which of the following chemical equations describes a
Diano4ka-milaya [45]

Answer:

Option C, disaccharide + H2O → monosaccharide + monosaccharide

Explanation:

In a hydrolysis reaction, the water molecule act as a chemical agent that breaks the chemical bond of a large molecule to form smaller molecules.

Disaccharide is a bigger molecule as compared to a monosaccharide. Or in other world disaccharide is twice the size of monosaccharide. Thus, in a hydrolysis process, water must react with disaccharide to produce two smaller monosaccharide.

Therefore, option C is correct.

4 0
3 years ago
What kinds of molecules are considered
Mazyrski [523]
The answer is C. Waste. Please give me brainliest!
7 0
3 years ago
1. Discuss the two types of reasoning and how they are used by scientists to develop and support a hypothesis​
denpristay [2]
The main difference between inductive and deductive reasoning is that inductive reasoning aims at developing a theory while deductive reasoning aims at testing an existing theory. Inductive reasoning moves from specific observations to broad generalizations, and deductive reasoning the other way around.
5 0
3 years ago
Other questions:
  • What is another name for the jaw bone?
    7·2 answers
  • Name five adaptations to a land environment that plants have developed
    6·1 answer
  • Most of the middle layer in the heart wall is composed of
    10·1 answer
  • True or false: an area that needs very fine movements, like the fingers or eyes, will have larger motor units.
    15·1 answer
  • How do signals move from a sensory neuron toward the brain?​
    13·1 answer
  • How does alcohol affect blood clotting?​
    13·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • What are the 4 major types of Systems of Spheres
    7·2 answers
  • First To Answer Correctly Gets Brainliest And A Hug!!!....Which of these is NOT a cell process? a. digesting food b. consuming n
    13·1 answer
  • 3. How does natural selection produce change?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!