1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
leva [86]
3 years ago
6

The menstrual cycle's hormone levels are shown below.

Biology
2 answers:
Snezhnost [94]3 years ago
6 0
A is the right answer
Hunter-Best [27]3 years ago
4 0
It’s A the luteinizing hormone
You might be interested in
Part B<br> What are the strengths and weaknesses of the cell model?
matrenka [14]

Answer:

strengths:The cell model shows all the process involved, and it's easy to understand, even if a person isn't familiar with the process

weaknesses: it doesnt show organelle or rna

7 0
3 years ago
Observing the temporal bone and locates the jugular foramen and the jugular fossa. what two types of bone markings has she ident
Mandarinka [93]
The 2 types of bone markings being identified would be the opening on the occipitomastoid suture in which the internal jugular veins would travel to carry the blood from one's brain to the heart and the Mandibular condyle of the mandible that would then form the temporomandibular joint.
7 0
3 years ago
To check for a torn ligament it would be best to use
Shalnov [3]
It would be best to use an MRI to check for any torn ligaments.

Hope this helps :)
5 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
A strand of DNA is a polymer of _________ , joined by covalent bonds between the__________ of one monomer and the_________ of th
Liula [17]

Answer:

"nucleic acids", "deoxyribose sugar, and the "phosphate"

6 0
3 years ago
Other questions:
  • How often does a birth of a baby occur in the us?
    14·2 answers
  • What might happen to the structure of kinesin if the DNA code was damaged?
    15·1 answer
  • Which of the following DOES NOT represent support for Wegener's hypothesis of continental drift?
    14·1 answer
  • Many animals foods like meat and fat are high in energy content. Where did this energy originate
    15·1 answer
  • What are the benefits of cell division in somatic cells?
    13·1 answer
  • An insect eats a leaf. Explain how the insect depends on the sun for energy.
    12·1 answer
  • Crystalline
    5·1 answer
  • Plz help I will mark you brainlist plz ​
    10·2 answers
  • What if the action potential never rests or not stopping? Some real-life examples of a person and what are the consequences?
    5·1 answer
  • what are the chances that a color blind man will have a color blind grandson what are the genotypes for all involved.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!