1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anarel [89]
3 years ago
6

Which type of tissue is not readily repaired if damaged ?

Biology
2 answers:
Vika [28.1K]3 years ago
6 0

Answer: The correct answer would be "tissues which have amitotic mature cells"

Explanation:

Nervous tissue, cardiac tissue, and muscle tissue, after some stage of growth become amitotic in nature. That is, their mature cells are no longer able to divide through the process of mitosis.

Usually in adulthood when overall body tissues have achieved the mature size then, several mitotic division processes are terminated. Only cells which get damage or abrasion are able to go through mitotic process to regulate healthy regeneration

However, there are many mature cells which become completely amitotic, that is, they can not repair themselves through mitotis even after damaged.

For example, in most of the mature neurons, centrioles are absent due to which their DNA can not get copied for replication.

Similarly, mature cardiac tissue is also not able to regenerate rapidly after damage.

Thus, the tissues whose mature cells are amitotic in nature for example, nervous tissue, cardiac tissue, et cetera are not able to repair themselves readily after damage..

Svetach [21]3 years ago
5 0
Most tissues in the body are capable to repairing themselves but the type of tissue that is not readily repaired when damaged are is the tissue of the nervous system. This is due to the complexity of the brain and the spinal cord. Once damage is not, permanent paralysis happens. 
You might be interested in
An operon is a group of genes under the control of a single promoter. match each type of operon with the descriptions below.
Leno4ka [110]
You didn't list any...

LAC = inducible repressor
TRP = repressive
4 0
4 years ago
A student in science class is observing a cell under a high-powered microscope and sees two structures that are found in both pl
Soloha48 [4]
Nucleus, rough and smooth ER, mitochondria, and vacuoles.
3 0
4 years ago
During photosynthesis which product is formed that cannot be broken into smaller units?
OleMash [197]

Answer:

I believe it is cellulose, I'm not a 100% sure

3 0
3 years ago
How to keep henna colour dark and vibrant?
Semmy [17]
Put coconut oil on skin
3 0
3 years ago
Multiple Choice
Zarrin [17]

Answer:

11B (reproduce). 12C (be eaten). 13A (variation). 14C (better adapted). 15C (Darwin). 16A (evolved). 17C (competition).

Explanation:

11 - The key principle underlying evolution by natural selection is that traits are only passed on if the organism survives long enough to reporduce. An adaptation that increases its likelihood of survival will therefore increase the chance it will reproduce.

12 - Deer rely on their brown fur to remain camouflaged in the forest so that predators can't see them. A white deer will stand out and will be seen by predators and eaten.

13 - This is the definition of variation. The variation becomes an adaptation if it actually benefits the organism in some way in its environment. A variation could also be neutral (doesn't affect the organism) or deleterious (bad).

14 - See previous question.

15 - Darwin developed the theory.

16 - This is describing the process of evolution.

17 - This is an example of competition.

4 0
4 years ago
Other questions:
  • What distinguishes a hypothesis from a theory??
    8·2 answers
  • An allele is only expressed at temperatures above 30°c. this is an example of a temperature- _____ allele.
    12·1 answer
  • Which statement best describes the components of nucleic acids?
    14·2 answers
  • "This is a large scale ocean water circulation driven by density differences due to the changes in surface water temperatures an
    13·1 answer
  • Rick uses an electronic air sampler to determine the amount of dangerous chemicals in the air.
    15·2 answers
  • Where do evolutionists derive support for their theories?
    10·1 answer
  • Following his afternoon classes, Darren stops at the cafeteria and eats a hot dog and fries. If you were to run a blood test on
    11·2 answers
  • Fill in the blanks:
    15·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • What is the k-t extinction?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!