1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anvisha [2.4K]
3 years ago
6

Investigator Benton uses several methods to analyze hair samples found at the crime scene. He examines the physical features of

the hairs, their color and shape, as well as the medulla of the hairs. Using the hair root, he tests for nuclear DNA and also for mitochondrial DNA. Which of these tests would most likely indicate the owner's identity?
Morphology
Medulla
Nuclear DNA
Mitochondrial DNA
Biology
1 answer:
enot [183]3 years ago
7 0
The answer should be the first one
You might be interested in
Which of the following is an accurate description of an adult stem cell?
frosja888 [35]
I believe the answer is C). My reason for this is because multipotency stands for multidifferentiative potential. And this is the ability to generate progeny of quite a few distinct cell types. And adult stem cells have that ability. Hope this helps.
4 0
3 years ago
The parietal bone has articulations with all of the following bones EXCEPT the __________. a. temporal bone b. frontal bone c. z
sp2606 [1]

Answer:

The parietal bone has not articulated with zygomatic bone.

Explanation:

Parietal bones are paired structure that form the roof and side of the cranium.

The parietal bones are articulated with each other and form suture.

It articulates occipital bone posteriorly,and anteriorly with the frontal bone which form a suture called as coronal suture.

Inferiorly the parietal bone is articulated with sphenoid and temporal bone.

Zygomatic bone is irregular shaped and paired structure that articulates with maxilla.temporal bone, sphenoid bone,frontal bone.

6 0
3 years ago
A person with a broken pelvis would probably be unable to _____________.
NeX [460]
I think the correct answer is C. Hope this helps.
5 0
4 years ago
Read 2 more answers
What food could.you chose to change the packaging to make it more.convenient and more eco.friendly
marshall27 [118]
Say for instance packaged ground beef meat or ground turkey meat. u could use a bio degradable packaging instead of styrofoam and plastic.
4 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • A new DNA strand elongates only in the 5' to 3' direction because A new DNA strand elongates only in the 5' to 3' direction beca
    6·1 answer
  • The Calvin cycle is considered light-independent because it can occur in darkness. However, most often the Calvin cycle takes pl
    7·1 answer
  • Why is genetic drift most common in small populations
    10·1 answer
  • What is the relationships between a gene and a protein
    13·1 answer
  • Ozone hole refers to...?
    11·2 answers
  • A fly has two alleles for the color of its eyes. The green allele is recessive, and
    14·2 answers
  • Give three examples of abiotic factors and explain how they interact
    14·1 answer
  • 78 points! I need help!!!!!!!!!!
    15·1 answer
  • Which of these contributors will transfer the greatest amount of carbon into the atmosphere while reabsorbing the least amount o
    12·2 answers
  • Please help i am giving brainiliest
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!