Answer:
What passage
Explanation:
please provide an example
The most accurate classification of the common forms of coronary artery disease and hypertension is that they are complex disorders which result from gene-environment interactions. For example, almost 60% of CAD cases are found in South East Asia, that too when their population if just 20% of the total world's population. This is due to the environmental interactions with the genetic disposition of the people of this region.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
The answer to this would be d. :)