1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Trava [24]
3 years ago
12

Who is the Father of Genetics, and about how many Pea Plants did he experiment with?

Biology
2 answers:
Alisiya [41]3 years ago
3 0
The genetic experiments Mendel did with pea plants took him eight years (1856-1863) and he published his results in 1865. During this time, Mendel grew over 10,000 pea plants, keeping track of progeny number and type. Mendel's work and his Laws of Inheritance were not appreciated in his time.
omeli [17]3 years ago
3 0

Answer:

Gregor Mendel

Explanation:

You might be interested in
Explain why algae swim up from the bottom of a pond during an afternoon
Effectus [21]

Explanation:

What happens during daytime is, oxygen that gets trapped between filaments of algae, moves them to the surface  and during night as O2 is not produced, they slowly sink to lower depths, and you don't see them

6 0
3 years ago
How does the cell membrane help to maintain the health of this cell
aniked [119]

Cellular homeostasis involves maintaining a balance of several factors that make a cell healthy. The cell membrane is a lipid bilayer that prevents the passage of water and ions. This allows cells to maintain a higher concentration of sodium ions out the outside of the cell.

tbh i searched it you can too B)

3 0
3 years ago
Analogous structures _____.
charle [14.2K]

if you are looking for the definition it is: Various structures in different species having the same function but have evolved separately.

Examples: wings of an insect and birds used for flying.    

Hope this helped :)

Have a great day

4 0
3 years ago
Read 2 more answers
Which organisms are the most diverse forms of life?
allochka39001 [22]
All organisms? i think
4 0
4 years ago
Which statement is always true when describing sex-linked inheritance? It results in a dominant trait. The alleles are found on
vazorg [7]

Answer:

the second one

Explanation:

there are only 2 sex linked chromosomes and that is X and Y

3 0
3 years ago
Read 2 more answers
Other questions:
  • At what stage and in what eon did the earth develop seasons?
    6·2 answers
  • What is the key term for the mass of bacteria that forms when bacteria are grown on agar?
    15·1 answer
  • Please help me with all of these...
    8·1 answer
  • How do bats navigate to find prey
    13·2 answers
  • In the human body, the cations of magnesium, iron, potassium, and zinc act as _____ to help speed up reactions. enzymes coenzyme
    8·2 answers
  • A researcher may claim a causal relationship between variables if one variable influences another
    13·2 answers
  • Inflammation of cardiac muscle 2. Inflammation of the sac surrounding the heart 3. Inflammation of the heart valves and chambers
    7·1 answer
  • You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATT
    15·1 answer
  • How to calculate the mass of sodium atom?
    7·1 answer
  • 19. What percent of forest is found in Nepal at present? 1. 50% 2. 28% 3. 29% 4. 39%​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!