1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
V125BC [204]
4 years ago
6

How can two species share the same habitat without driving the other to extinction?

Biology
1 answer:
Scrat [10]4 years ago
6 0
It is not possible for two species with the same niche to coexist. one species will eventually drive the other into extinction

You might be interested in
Katherine and Amy are members of the same sorority at college and are members of the school's swim team. They have been trying t
aniked [119]

Answer:

Option (A).

Explanation:

Sociology may be defined as the subject that focus on the study of development and social interaction in society. Sociology is also known as the general science of the society.

Amy and Katherine are the member of same team and Amy shows fast development than Katherine. They both are competitor of each other. This is human behavior to jealous with the person that perform better than them. Here, the development of Amy makes jealous to Katherine and she starts disliking Amy.

Thus, the correct answer is option (A).

5 0
4 years ago
Hotspots are plumes of magma that originates deep below the ______. with respect to overlying plates, these plumes can remain __
rusak2 [61]

The hotspots are regions, where the plumes of magma are present just below the lithosphere. The plume of the magma is the particles of the volcano and the gases, which is erupted during the volcanic eruption. It is generated by the fragmentation of the magma. Once, it reaches the lithosphere, it get spreaded laterally.

The plumes at the hotspots are present just below the tectonic plates, a high temperature r heat and the low pressure causes the rocks present in the lithosphere to melt resulting in volcanic eruption. At hotspot, the melting of rock takes time, sometimes it is very slow, due to the presence of various tectonic plates. Hence, the plumes can remain stationary for a very long period of time without erupting.

So, the first blank can be filled with Lithosphere and the second blank can be filled with Stationary.

7 0
4 years ago
Three main steps in the process of DNA replication. Name the enzymes that go with each step
Llana [10]

Answer:

The three mains in the process of DNA replication are 1 initiation 2 elongation 3 termination.

Explanation:

Enzymes those function during initiation

1 Helicase.

2 single strand binding protein.

3 Topoisomerase.

Enzymes those function during elongation

a DNA polymerase alpha

b  DNA polymerase delta

c  DNA polymerase epsilon

Enzymes those function during termination

1 Replication protein A

2 Replication factor C

6 0
3 years ago
Darwin’s observations of finches indicated descent with
RSB [31]
Darwin’s observations of finches indicated descent with Modification in bills.<span>
They had become adapted to eating different diets, </span>Beak shape of finches is affected by the type of food available to eat. Finches<span> are generally seedeaters and eat a variety of plant seeds. There are times though that their diet will be composed of insects and certain fruits, berries and vegetation.</span>
5 0
3 years ago
Which substance do we consider to be the elementary unit of life?
zimovet [89]

Answer:

a. DNA is the correct answer

Explanation:

because DNA is the controller of everything

5 0
3 years ago
Read 2 more answers
Other questions:
  • If a human system fails to function properly,what is most likely to result
    6·1 answer
  • A PAIR of unbroken DOUBLE-yellow lines several feet apart indicates
    6·1 answer
  • In airports the control tower functions in directing air traffic and keeping all flights running smoothly like a command center.
    5·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which statement is true about nuclear decay?
    7·1 answer
  • In which stage of the cell cycle does the nuclear membrane and nucleolus form
    15·1 answer
  • Know the major arteries/veins and how they split off into other named arteries/veins
    15·1 answer
  • Why are certain amino acids called essential amino acids 
    10·1 answer
  • In what two places in the cell can translation occur.
    7·1 answer
  • Transpiration is regulated by the movements of
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!