1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olenka [21]
3 years ago
6

The element nitrogen has the atomic number 7 and an atomic mass of 14. How many neutrons does an atom of nitrogen contain? A. 14

B. 7 C. 0
Biology
1 answer:
Roman55 [17]3 years ago
3 0

Answer:

the element nitrogen contain 7 neutrons

You might be interested in
If four cells went through mitosis at the same time how many daughter cells would be formed? ​
Vladimir [108]
Two cells would be formed
8 0
3 years ago
Oxygen was into ally created in earths atmosphere by___.
Mariulka [41]
Here something that might help 
<span>
Most scientists believe that for half of </span>Earth's<span> 4.6-billion-year history, the</span>atmosphere<span> contained almost no </span>oxygen<span>. Cyanobacteria or blue-green algae became the first microbes to produce </span>oxygen<span> by photosynthesis, perhaps as long ago as 3.5 billion years ago and certainly by 2.7 billion years ago.</span>
7 0
3 years ago
Read 2 more answers
What happens in each stage of Interphase?
den301095 [7]
Interphase is composed of G1 phase (cell growth), followed by S phase (DNA synthesis), followed by G2 phase (cell growth). At the end of interphase comes the mitotic phase, which is made up of mitosis and cytokinesis and leads to the formation of two daughter cells.
5 0
2 years ago
The coral reef ecosystem is said to be stable and not extreme. Describe what this means along with how it affects the food chain
Mandarinka [93]

sea creatures and fish may lose their homes because one, they live their, and two, animals they may eat live there, so if their food leaves, they will die out or they might leave.

3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • 11) Nutrients enter a cell ______ the concentration gradient by the process of _______
    9·1 answer
  • Describe how cell cycle is regulated
    13·1 answer
  • All eukaryotic cells have a.
    15·1 answer
  • Pls help i dont understand :( Will give Brainliest + 25 Points!!!
    8·1 answer
  • Explain how the body prevents particles in inspired air from reaching the gas<br> exchange surfaces.
    13·1 answer
  • How does the environment influence<br> genetic traits?
    9·1 answer
  • Would you expect there to be fewer snails or fewer bass in this ecosystem?​
    10·2 answers
  • Reptile respiratory organs​
    8·2 answers
  • ¿Que dos moléculas necesitan las plantas para la fotosíntesis?
    10·1 answer
  • How long is the auditory canal​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!