1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna11 [10]
3 years ago
14

In angiosperms, what is the name of the outer epidermal layer that protects the plant body?

Biology
2 answers:
otez555 [7]3 years ago
7 0
<span>The Dermal Tissue (B) is the outer part of the plant that covers the surface of the plant. This epidermal layer protects the soft tissues of plants, protects the plant from injury and water loss and controls interactions with the plants' surroundings.</span><span />
natulia [17]3 years ago
6 0

The correct answer is

B. dermal tissue

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Glycolysis is the first stage of cellular respiration producing ATP. What is the net gain of ATP molecules per molecule of gluco
Lunna [17]
8 ATP are formed from glycolysis
5 0
3 years ago
What would be an immediate effect of the construction of roads and parking lots on the transfer of energy from producers to cons
motikmotik
It would be C because of the parking lots and roads there would be more producers

Can I be brainliest please
7 0
3 years ago
Read 2 more answers
Enzymes in the digestive tract are composed of which of the following?
emmainna [20.7K]
They are composed of proteins. I cannot see the options but hopefully that answer is in one of them
5 0
3 years ago
Which of the following is NOT a characteristic of the northern boreal forest (taiga) biome?
Alik [6]

Answer: d. High biodiversity in the understory.

Explanation:

The taiga or boreal forests are the largest biome in the world. These can be found in the regions of North America, Alaska, and United States. These regions exhibit extreme weather conditions. Typically long winters and moderate to high precipitation. The soil is permafrost and nutrient poor as no new organic matter can be added up to the soil due to it's freezing condition. The plant growth is scanty and biodiversity is low because organisms are incapable of surviving in the harsh weather conditions.

8 0
3 years ago
Other questions:
  • Explain the different niches that exist within your household between you and your family members. (Remember that a niche is the
    12·1 answer
  • In one to three sentences, describe what happens during the regeneration stage of the Calvin cycle.
    9·2 answers
  • Can you determine which instances reflect a valid experiment or conclusion? Check only those that are valid.
    8·1 answer
  • The rotation is responsible for what we call _________; the tilt on the axis influences the ________.
    6·1 answer
  • How does the number of cells relate to the functioning of the organism
    11·1 answer
  • Which type of cell can not reproduce by Mitosis?
    13·1 answer
  • a cell has 10% salt solution and 90% water solution,while the beaker has 30% salt solution and 70% water solution. what happens
    5·1 answer
  • I need help with this assigment. If you help me, I will mark your answer as brainliest. This question is worth 20 points!
    13·1 answer
  • 5. Only
    5·1 answer
  • How do we know when the moth species Stigmella
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!