1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vilka [71]
3 years ago
8

The genetic engineering of crops is a controversial and debated issue in the media and press. Which of the following would be an

argument in favor of the genetic engineering of corn?
A) improved nutritional content


B) increased crop yields


C) reduction of pesticide use


D) all of these
Biology
2 answers:
Gwar [14]3 years ago
4 0
The answer would be D. all of these
Firlakuza [10]3 years ago
4 0
It is 100% the last one

D) All of these
You might be interested in
When elements and components that are dissolved in water leave a solution what is the result
rosijanka [135]

Answer:

-A solution is a mixture in which one substance is dissolved in another. When elements and compounds that are dissolved in water leave a solution, crystallization occurs.

Explanation:

Hope it helps : ))

7 0
3 years ago
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
3 years ago
How can you determine if your cardiovascular system is becoming more fit?
Alex17521 [72]
To determine if the cardiovascular system is becoming more fit as a result of fitness program, the resting heart rate should be going slower. Cardiovascular system is the system of the body that allows the circulation and transportation of nutrients, oxygen, hormones, carbon dioxide through out the body. It includes the blood vessels, the lungs, the heart and the blood.
5 0
3 years ago
___are structures that allow for one-way blood flow through the heart.
qwelly [4]

The answer is Valves.

7 0
3 years ago
Read 2 more answers
Which statement correctly describes this atom?
KengaRu [80]

Answer:

the basic unit of a chemical element.

atoms as a source of nuclear energy.

6 0
3 years ago
Other questions:
  • A molecule whose ends have opposite electric charges is called a _____ molecule.
    7·2 answers
  • What are some limiting factors?
    9·1 answer
  • What are some mechanisms of variation
    15·1 answer
  • Organic compounds do NOT contain which of the following?
    13·2 answers
  • Select the best answer for the question
    15·1 answer
  • Consider the cladogram representing most of the major categories of animals. Consider the point B in the cladogram. What charact
    13·2 answers
  • Which of the following would be the best method for randomly choose in the next nucleotide to add to an imaginary DNA segment
    5·1 answer
  • A cell in the body is recognized as "self" by its _________ and is therefore not targeted by the immune response for destruction
    10·1 answer
  • What’s Newton’s first law
    9·1 answer
  • What are the reason that make our planet earth habitable
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!