1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
beks73 [17]
3 years ago
14

Please help science btw i’ll give brainly

Biology
2 answers:
Semmy [17]3 years ago
6 0
I believe the answer is D. The velocity, speed, and acceleration
kramer3 years ago
3 0
Nicki Minaj is the queen of rap!!!!!
You might be interested in
How many years does succession take
olga55 [171]

this is my fight song this is mgfi

7 0
3 years ago
Read 2 more answers
Which of these has a warming effect on Earth? O A. More evaporation of water due to warmer temperatures causes low, thick clouds
Phoenix [80]

Answer:

A

Explanation:

Thick clouds can trap lots of heat. This has a warming effect on earth.

4 0
3 years ago
Which of the following tasks is an example of how scientists might use writing skills in their jobs?
Molodets [167]
I didn’t see any of the following but I can say that one reason they use it is to record their findings
5 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
A muscle's ability to perform contractions for a length of time is muscle
nata0808 [166]
Muscle spasms is the answer i belive because you dont have the control
3 0
3 years ago
Other questions:
  • Give the equations for the two possible anaerobic respiration reactions.
    6·1 answer
  • The paired, rod-shaped ____ cartilages are located in the mucous membrane fold that connects the epiglottis to the arytenoid car
    14·1 answer
  • Host give food what is host
    9·2 answers
  • Why is pH an inverse measure of the concentration of hydronium ions in a solution? Any help is appreciated:)
    11·1 answer
  • Which diagrams shows reaction pathway that absorbs energy?
    12·1 answer
  • During what phase is the chromosomes number reduced from 2n to n?
    13·1 answer
  • How Primary and secondary succession happen?
    10·1 answer
  • Water requires a very large amount of energy to undergo a change of state compared to most molecular compounds.
    13·2 answers
  • The use of vaginal inserts of Lactobacillus cells to restore healthy vaginal biota is an example of ________.
    13·1 answer
  • Science I need to know the answer
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!