1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timofeeve [1]
3 years ago
8

When oxygen binds to a heme-containing protein, the two open coordination bonds of fe2+ are occupied by:?

Biology
1 answer:
gogolik [260]3 years ago
8 0
I believe that the two open coordination bonds of Fe2+ are occupied by one oxygen molecule and one amino acid atom. 
Heme protein is a protein that contains a heme prosthetic group. The heme group confers functionality, which can include oxygen carrying, oxygen reduction, electron transfer, and other processes. Hemoglobin contains four heme units in total, allowing four oxygen atoms in total to bind to the protein.
You might be interested in
Which action is a reflex action
tekilochka [14]

Answer:

A reflex, or reflex action, is an involuntary and nearly instantaneous movement in response to a stimulus. A reflex is made possible by neural pathways called reflex arcs which can act on an impulse before that impulse reaches the brain.

Explanation:

3 0
3 years ago
How the animals and plants of a healthy ecosystem are organized and interact.
vlabodo [156]

Answer:

A healthy ecosystem consists of native plant and animal populations interacting in balance with each other and nonliving things (for example, water and rocks). ... Decomposers break down dead plants and animals, returning vital nutrients to the soil. Plants take up these nutrients, along with water, through their roots.

Explanation:

6 0
3 years ago
Which type of solution most reminds you of equilibrium?
marin [14]

Answer:

C

Explanation:

4 0
3 years ago
What is the science definition of work
Evgen [1.6K]

Answers

Work is the ability to do something

Very simple

8 0
3 years ago
What are two ways to reduce air pollution and slow climate change?
alisha [4.7K]
If you can connect air pollution leads to global warming and thus climate change.
So in order to decrease pollution levels
1. Lessen the usage of vehicles (motorised)
2. Industrial waste should be treated properly before releasing into the atmosphere
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following structures is made up mostly of water
    7·1 answer
  • Describe the path of nitrogen from the atmosphere to plant protein nitrogen fixing bacteria
    13·1 answer
  • Ricky is interested in the health and safety of animals and humans. She wants to pursue a career that allows her to monitor dise
    10·1 answer
  • Plants and animals are "multicellular". What if you find some green pond algae?
    12·1 answer
  • Bacteria are prokaryotic cells. By contrast, animal, plant, and fungal cells are eukaryotic. What is the main difference between
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • A scientist is attempting to build a cladogram that shows the evolutionary closeness of three organisms in relation to humans.
    15·1 answer
  • Please help me
    13·2 answers
  • Climate Change Basics:Question 3
    11·1 answer
  • Which Scientist would most likely be interested in studying food poisoning caused by E. coli (Escherichia coli)?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!