1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Strike441 [17]
3 years ago
7

Who argued that cities brought a more impersonal transitory way of life to people?

Biology
2 answers:
slava [35]3 years ago
5 0
The correct answer would be Louis Wirth 
Citrus2011 [14]3 years ago
5 0

The correct answer would be Louis Wirth according to sociology studies


You might be interested in
DNA is able to control cellular activities most directly by regulating the process of
valina [46]
DNA is able to control cellular activities most directly by regulating the process of Protein synthesis.
5 0
3 years ago
Which statement is true of all living things?
N76 [4]
D. They come from other living things

Explanation:
The cell theory states that all living things come from preexisting cells. 
5 0
3 years ago
Read 2 more answers
Why where phosphates removed from dishwasher detergents
Vikki [24]
So she says without phosphates, people have to wash or rinse their dishes before they put them in the dishwasher, which wastes water. Or they run their dishwasher twice, which wastes electricity. ... That's what happened with laundry detergents after phosphates were removed from them years ago
4 0
3 years ago
What part of the brain do we use when initiating skeletal muscle movement?
slega [8]
The PRIMARY MOTOR AREA is the part of the brain we use to initiate skeletal muscle movement.

The primary motor cortex, or M1, is located in the frontal lobe of the brain, along the precentral gyrus. Its primary role is to generate neural impulses that control the execution of movement.
8 0
3 years ago
What will i do to meet my goals?​
grigory [225]

Answer:

Study and believe in yourself,don't give up!

7 0
3 years ago
Read 2 more answers
Other questions:
  • The muscular system helps maintain body temperature. Explain why humans shiver in the cold. Be sure to discuss the process of ce
    9·1 answer
  • GTPases serve in many signal transduction pathways and the presence of GTP or GDP dictates where the pathway is on or off, respe
    7·1 answer
  • A woman in her 20s has experienced a miscarriage at 10 weeks' gestation and asks the nurse at the hospital what went wrong. she
    11·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • inductive reasoning is empirical in nature, which means that it is based on _______ and observations from the real world
    13·2 answers
  • Plants can respond to changing environmental conditions like temperature and amount of daylight.
    11·1 answer
  • DNA replication occurs during which phase of the eukaryotic cell cycle?
    8·1 answer
  • Label the diagram for photosynthesis
    9·1 answer
  • What is COPER -T in hindi​
    6·2 answers
  • What information can a scientist learn directly from a single fossil?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!