1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksi-84 [34.3K]
3 years ago
12

Within a DNA molecule, which nitrogen base pairs with cytosine (C)?

Biology
1 answer:
vlabodo [156]3 years ago
6 0
The answer D. guanine (G)
You might be interested in
Can you tell us about inorganic components?​
natka813 [3]

Answer:Inorganic compound, any substance in which two or more chemical elements (usually other than carbon) are combined, nearly always in definite proportions. Compounds of carbon are classified as organic when carbon is bound to hydrogen.

Explanation:

3 0
3 years ago
Trypsinogen is split by the enzyme enterokinase to form an activated molecule of the protease trypsin. Which of the following wo
Naddika [18.5K]
<h3><u>Full Question:</u> </h3>

Trypsinogen is split by the enzyme enterokinase to form an activated molecule of the protease trypsin. Which of the following would confirm that the activation of trypsin is an example of how a positive feedback mechanism can amplify a biological process?

A. The activated trypsin enzyme can use enterokinase as a substrate

B. The trypsin produced by the reaction is capable of splitting and activating additional trypsinogen molecules

C. If levels of trypsin were to get too high, the trypsin molecules would inhibit the enzyme enterokinase

D. Each mRNA molecule that codes for trypsinogen can be translated repeatedly to form many peptide molecules

<h3><u>Answer:</u></h3>

Trypsinogen molecules are first split into the active enzyme Trypsin by enterokinase. Then the Trypsin being a protease itself, works on Trypsinogens and converts them to Trypsin. Thus this is a positive feedback.

Option B

<h3><u>Explanation:</u></h3>

Trypsinogen is a proenzyme which is secreted by pancreas into the duodenum. Enterokinase is a intestinal enzyme that is secreted from the small intestinal glands. Enterokinase works on the Trypsinogens to convert them into trypsin by splitting a peptide chain from the proenzyme. This trypsin then digests a variety of proteins and peptides from diet.

Trypsin is a protease and the proenzyme Trypsinogen is a protein. So trypsin works on the secreted trypsinogens too and amplify the production of trypsin from the trypsinogens to enhance the digestion process. Thus, a positive feedback chain is seen here.

3 0
3 years ago
What's the total number of different arrangements in dna molecule with 2 base pairs?​
kherson [118]

Answer:

23

Explanation:

3 0
3 years ago
Read 2 more answers
How many electrons surround the<br> nucleus of an atom of Carbon?
mylen [45]

Answer:

it has 2 atoms of carbon

Explanation:

6 0
3 years ago
Read 2 more answers
What is the correct term for a light particle?
oee [108]
A photon.

The main point of his light quantum theory is the idea that light's energy is related to its oscillation frequency (known as frequency in the case of radio waves).
6 0
3 years ago
Read 2 more answers
Other questions:
  • Evolution does not occur in a straight line with one species another in a series of orderly steps
    9·1 answer
  • 10. Which combination of climate factors generally result in the coldest temperatures ?
    14·1 answer
  • One major difference between the inner and outer planets is that the
    6·2 answers
  • describe how the heart as a muscle does its job of pumping blood.what happens if the cardiac muscle itself doesnt get enough blo
    6·2 answers
  • A plant absorbs 200 J/g of energy from the sun. A cow eats the plant and absorbs 120 J/g of energy. The cow is fed to a group of
    14·2 answers
  • 3. What is different about the blood carried by the arteries going to the body and the blood carried by the arteries going to th
    6·2 answers
  • Granite is a coarse or medium-grained rock that is rich in quartz and feldspar. It is formed when bodies of magma cool and harde
    10·1 answer
  • Which is the right answer?
    9·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • PLEASE HELP BIOLOGY!! WILL GIVE BRAIN!!
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!