1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
poizon [28]
2 years ago
15

How do volcanoes provide evidence to scientists to support the idea that matter and energy move within the Earth’s interior?

Biology
1 answer:
grin007 [14]2 years ago
7 0

Answer:

Scientists use volcanic activity data from this area to show the relationship between volcanic activity and lithospheric plate motion. Hot Spots and Plate Tectonics: A volcanic hot-spot is an area in the mantle from which heat rises in the form of a thermal plume from deep within the Earth. Higher heat and lower pressure at the base of the lithosphere melts rock and forms magma.

Explanation:

energy moves through everything really

You might be interested in
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
olchik [2.2K]

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

8 0
3 years ago
What happens when identical objects are dropped under<br> different gravitational conditions
CaHeK987 [17]
One will fall faster than the other, but only if the gravitational force applied to each one is different

3 0
2 years ago
Joyce and Linda are identical twins who are 50 years old and enjoy exercising daily. Joyce avoids eating any dairy or animal pro
Svetlanka [38]

Answer:

Linda has a higher level of “bad” cholesterol than Joyce.

Explanation:

8 0
2 years ago
How is lateral gene transfer different from the gene duplication that occurs during cell division?
Lena [83]

Answer:

Transmission of genetic information from parent to offspring is termed vertical gene transfer. Lateral movement, or movement of genetic information from a donor to an unrelated recipient, is called horizontal gene transfer.

Explanation:

( happy to help) :)

5 0
3 years ago
The base of an energy pyramid is always composed of _______________.
Rudik [331]

Autotrophs!!!!!!!!!!!!

7 0
2 years ago
Other questions:
  • Jason is a college football player who works out for 60 minutes per day, at least 5 days a week. he weighs 230 pounds, and his b
    9·1 answer
  • Disruptive selection favors which phenotypic traits?
    6·1 answer
  • Ecological blank are a collection of plants,animals, and microorganisms residing in a habitat
    7·1 answer
  • What property of the phospholipid bilayer allows proteins to move laterally in the membrane?
    5·1 answer
  • Catabolic pathways _____.
    11·1 answer
  • Melosis ____
    14·1 answer
  • Is the skin on the back of my hand living or nonliving?
    15·1 answer
  • Describe homeostasis. How does the cell membrane maintain a stable internal environment?
    12·2 answers
  • I need help with this question now please
    10·1 answer
  • A strand of messenger RNA is attached to a ribosome and is directing protein synthesis. The next exposed codon of this messenger
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!