1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saveliy_v [14]
3 years ago
10

Reviewing Your Knowledge E X E R C I S E 18 A. Connective Tissue Coverings Identify the connective tissue covering. ____________

__________ 1. ______________________ 2. ______________________ 3. Covers unmyelinated or myelinated axons Covers fascicles Covers nerves
Biology
1 answer:
inna [77]3 years ago
5 0

Answer:

1. Endoneurium covers the myelinated or unmyelinated axons. it is a layer of delicate connective tissue that envelops the myelin sheath of each of the myelinated nerve fiber.  

2. Perineurium covers fascicles. It is the connective tissue sheath that envelops fascicle of nerve fibers within a nerve.  

3. Epineurium covers nerves. It is the outermost layer of dense irregular connective tissue that envelops the peripheral nerve and multiple nerve fascicles.  

You might be interested in
Αи αєяο ρℓαиє ƒℓìєѕ ωìτн α ѕρєє∂ οƒ 720κмн. нοω ℓοиg ωìℓℓ ìτ τακє το τяανєℓ α ∂ìѕταиϲє οƒ 360 κìℓοмєτяєѕ?
AveGali [126]

Answer:

Given that,

Distance=360\:Kilometres

Speed = 720 KM/hr

time=360km/720kmh^{-1}

time=1/5 hr

Time = 30\: minutes \:or \:1/5 \:hours \: or \: 0.5 \:hours.

<u>OAmalOHopeO</u>

3 0
3 years ago
Read 2 more answers
How to use bacteria as a treatment for sewage waste
konstantin123 [22]

Answer:

Aerobic bacteria can be used to use the available oxygen in the water to degrade the pollutants in the waste and convert it into energy it can use for its metabolic processes.

6 0
3 years ago
Oxygen crosses the cell membrane by
Dimas [21]

Answer:

diffusion

Water, carbon dioxide, and oxygen are among the few simple molecules that can cross the cell membrane by diffusion (or a type of diffusion known as osmosis ).

Explanation:

3 0
3 years ago
How many times a day does a specific location experience high tide?
DENIUS [597]
A specific location will experience high tide, and low tide twice per day.
4 0
3 years ago
A plant nutrients needed in small qualities is called
Lady_Fox [76]
Oxygen, carbon, nitrogen
3 0
3 years ago
Other questions:
  • What are cells with a nucleus called? eukaryotic cells nuclear cells prokaryotic cells membrane cells
    8·1 answer
  • Which would provide the body with the most energy?
    7·1 answer
  • To reiterate instructions A. mediae on B. confuse C. explain D. repeat E. revise
    7·2 answers
  • Fill in the blanks with vocabulary and enzyme terms. All answers should be in lower case The two strands of the DNA are one stra
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • During this phase of cell division chromosomes settle at opposite ends and
    15·1 answer
  • Which of these stopped operating in 2011? A. space shuttle program B. Kepler Space Telescope C. Hubble Space Telescope D. Intern
    9·1 answer
  • You discover a new organism while investigating a meteor that recently crashed. While observing it,
    10·2 answers
  • In your own words, define what natural resources are and explain why they are important.
    10·2 answers
  • 1.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!