1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Orlov [11]
3 years ago
5

Describe where in the cell starch grains are found.

Biology
1 answer:
Sergeu [11.5K]3 years ago
7 0
Search Results by science:
Featured snippet from the web
In some plants, starch is stored in cell organelles called amyloplasts. Some plant roots and embryos, in the form of seeds and fruit, also serve as storage units for starch. Cells in plant leaves produce starch in the presence of sunlight.
You might be interested in
Humans evolved ______billion years after the earth was formed
Novosadov [1.4K]
Humans evolved 3 billion years ago after the earth was formed.<span />
4 0
2 years ago
Arthropods like mites and ticks can transmit rickettsial diseases.
Nadya [2.5K]
Yes they can and many more
6 0
3 years ago
In a group of 1,500 people, 585 have blood type A, 165 have blood type B, 690 have blood type O, and 60 have blood type AB. What
MAXImum [283]
The answer is B.
165/1500 = 0.11
0.11 * 100 = 11.
4 0
3 years ago
Read 2 more answers
What is an example of eukaryote
Fiesta28 [93]

eukaryote is a single celled organism, so that is almost like every organism on earth (except for bacteria). so actually there are many examples

1. bananas

2. algae

3. a spider

4. a lion

5. mushroom

4. tress, grass, flowers, pines....etc

5. humans

6. cancer cells, animal cells, sperm cells, muscle cells, plant cells...etc

5. flies almost every type of fly

6. fish

so yeah you get it almost every organism is a single celled organism :D

(except for bacteria and virus)


8 0
2 years ago
Which part of the water cycle involves water moving from the land to lakes and streams?
LekaFEV [45]

Answer:

B. surface runoff

Explanation:

Surface runoff is the flow of water that occurs when excess storm water, melt water, or other sources flow over the Earth's surface.

hope this helps

8 0
3 years ago
Read 2 more answers
Other questions:
  • 1. What does the skeletal system protect?
    8·1 answer
  • Which of the following statements describes the difference between physical and chemical (1 point)
    10·1 answer
  • In the fruit fly Drosophila melanogaster, the recessive allele (p), when homozygous, determines pink eyes. Pp or PP results in w
    6·1 answer
  • How does neural transmission compare to endocrine signal transmission?
    7·2 answers
  • BRAINLIESTTTT ASAP!!!!!!
    8·2 answers
  • What is the name given to cell division in eukaryotes
    5·2 answers
  • What is the function of NADH?
    5·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Gigi was trying to classify an animal as a mammal. What would be the best characteristic of a mammal?
    7·2 answers
  • Which of the following is a cause of a DNA mutation?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!