1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vredina [299]
4 years ago
15

Which type of tissue lines your internal organs

Biology
1 answer:
Stells [14]4 years ago
6 0
The tissue type that lines the internal organ is called the epithelial
You might be interested in
How does the structure of the spins cord being long and flexible help it with its function
gulaghasi [49]

Explanation:

The spinal cord functions primarily in the transmission of nerve signals from the motor cortex to the body, and from the afferent fibers of the sensory neurons to the sensory cortex. It is also a center for coordinating many reflexes and contains reflex arcs that can independently control reflexes.

3 0
3 years ago
Which of the following is an example of the endocrine system directly interacting with the nervous system?
Delvig [45]

Answer:

B.

Explanation:

A gland in the endocrine system is made up of groups of cells that function to secrete hormones. The endocrine system works together with the nervous system to influence many aspects of human behavior, including growth, reproduction, and metabolism. And the endocrine system plays a vital role in emotions

6 0
4 years ago
What tissue surrounds, protects, and strengthens the synovial joint with dense collagen fibers?
Andreyy89
It is b because we know that we learn these in science
6 0
3 years ago
Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For thi
Likurg_2 [28]

Answer:

DNA: ATGGGGGCGATATTTTATCCGACG

RNA: AUGGGGGCGAUAUUUUAUCCGACG

Protein: MGAIFYPT

Explanation:

Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.

7 0
3 years ago
How can some water be used even if it isnt clean enough to drink
elena-s [515]
The water can be used for cleaning, bathing (depending on how clean the water is), washing hands, toilet water etc
8 0
3 years ago
Other questions:
  • A neutron star collapses into a black hole because of the force of fusion or gravity
    15·1 answer
  • The fossil of a plant reveals that it produced spores that were used for reproduction. Which type of plant was it
    6·1 answer
  • Why do the components of maternal cytoplasm influence early development?
    11·1 answer
  • Vitamin D is unique in that it can be obtained by the diet but also is synthesized inside the body when a cholesterol-like subst
    10·1 answer
  • About two-thirds of human caloric intake consists of wheat, rice, and corn. What tissues constitute the majority of the nutritio
    10·1 answer
  • The genetic code is carried by the _____ molecule in most organisms.
    6·2 answers
  • How will you be able to tell the differences between vertebrate and invertebrate material
    6·1 answer
  • Choose the correct statement.
    8·2 answers
  • The part of Earth that contains living things is:
    14·1 answer
  • Please help!!!! Grizzly bears and polar bears are very closely related, so much so that they can reproduce to form hybrid offspr
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!