1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergij07 [2.7K]
3 years ago
12

Which mechanism causes postzygotic reproductive isolation?

Biology
1 answer:
Alik [6]3 years ago
4 0

Explanation:

Hybrid sterility cause postzygotic reproductive isolation.

You might be interested in
Are teens who lack sleep more prone to becoming overweight, using alcohol and drugs, and mental illnesses and suicideal
yan [13]
Several studies of adolescents<span>, including one </span>with more<span> than 3,000 high school students, found that inadequate </span>sleep<span> is associated </span>with<span> higher levels of depressed mood, anxiety, behavior </span>problems,<span>alcohol use, and attempted suicide. </span>
7 0
3 years ago
How can the amount of ethyl alcohol in various drinks be determined?
IRISSAK [1]

 

Ethyl alcohol is one of the series of organic chemical compounds in which a Hydrogen (H) attached to carbon is replaced by a hydroxyl (OH). It is made from sugar, starch and other carbohydrates by fermentation with yeast and synthetically from ethylene or acetylene. It has been used in beverages which has unstable, combustible, colorless liquid with slight distinctive odor. The amount of Ethyl alcohol in any drinks can be determined by multiplying the percentage (%) of alcohol and size.



8 0
3 years ago
PLEASE I NEED HELP WITH THIS SCIENCE HOMEWORK WILL GIVE BRAINLIEST
olga55 [171]

Answer:

1. Nucleus

2. Nuclear DNA

3. Chromosomes. They contain the DNA.

4. This is DNA. DNA contains the instructions needed for an organism to develop, survive and reproduce.

5 0
3 years ago
Read 2 more answers
What is the scrotum and where is it (;...
Jobisdone [24]

The scrotum is a sac of skin that hangs from the body at the front of the pelvis, between the legs. It sits next to the upper thighs, just below the penis. The scrotum contains the testicles

3 0
3 years ago
Read 2 more answers
A scientist measures the circumference of acorns in a population of oak trees and discovers that the most common circumference i
Vinil7 [7]

Disruptive selection or diversifying selection describes the changes in population genetics where extreme values for a trait are favored over intermediate values.

So according to this definition, the conclusion can be derived as :

The most common circumference(s) to be after 10 generations of diversifying selection will be greater than 2 cm and less than 2 cm.

8 0
3 years ago
Other questions:
  • How does the cell membrane demonstrate selective permeability?
    9·1 answer
  • Where do you think they found fossil evidence of simple land plants and amphibians
    7·1 answer
  • How many alleles are there for the four main types of human blood?<br> Please answer fast
    6·1 answer
  • Kyra smith, who is 58 years old and postmenopausal, is seen at the women's health clinic for a routine checkup. she reports no h
    11·1 answer
  • What are 3 things that are done to the each internal organ during an autopy?
    9·1 answer
  • Identify the characteristics of life. Check all that apply.
    10·2 answers
  • Mark's misuse of alcohol and other addictive drugs is influenced by genetic factors, by the ready availability of drugs in Mark'
    13·1 answer
  • Which of the following sciences is not considered a natural science?
    10·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • 1. What is the relationship among chromosomes, genes, and DNA?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!