1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
madam [21]
4 years ago
11

What do you call a very large quantity of something? _B_ _ _ _ _ CE

Biology
1 answer:
Marianna [84]4 years ago
5 0
Abundance. Hope this helps :))
You might be interested in
a warming global climate can create hot and dry regions. it can also contribute to natural CO2 emissions. For example, lighting
motikmotik

<em>b. wildfires</em>

<em>b. magnified the greenhouse effect</em>


The first blank is pretty simple; if lightning (electricity) strikes something flammable, like a forest, a fire is sure to ensue. This fire will obviously spread to the other trees and cause a massive wildfire.

The second blank is the greenhouse effect. The greenhouse effect is said to have caused our warming climate, which makes sense because heat from the sun gets trapped in our global "greenhouse", or the lower atmosphere. Lower atmosphere is key here because a large event like a massive wildfire can add some more heat to the atmosphere and contribute to this effect. A wildfire may seem like a minor event on a global scale, but it will do more damage to the atmosphere than you think!

9 0
3 years ago
Read 2 more answers
A friend asks you how exocrine glands differ from endocrine glands. She knows that both form from invaginated epithelium. How do
klio [65]

Answer:

Exocrine glands secrete sweat and oil while endocrine glands secrete hormones.

Explanation:

As she knows the endocrine and exocrine glands in respect of their origin from skin, so our answer must be related to the skin so that she can understand easily. So our answer should be as follows -

  • Endocrine glands are those glands which secrete hormones directly to the blood stream but exocrine glands are those glands which secrete sweat and oils directly to the skin surface.
  • A duct is often present in exocrine glands but endocrine glands lack ducts.
4 0
3 years ago
Name 2 differences between plant and animal cells.
Zanzabum

A plant cell contains a large, singular vacuole that is used for storage and maintaining the shape of the cell. In contrast, animal cells have many, smaller vacuoles. Plant cells have a cell wall, as well as a cell membrane. Animal cells simply have a cell membrane, but no cell wall.

3 0
3 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
4. Scientists have most accurately determined the absolute ages of rock layers by
Vladimir [108]

Answer:

B

Explanation:

7 0
3 years ago
Other questions:
  • A higher concentration of molecules causes a faster chemical reaction. This is known as _____.
    14·1 answer
  • If homeostasis is not maintained, what disease/disorder may occur in the respiratory system
    5·1 answer
  • Is the question is it ethical to eat meat testable?
    10·1 answer
  • 1. Which of the following flowers can be white in color?
    11·1 answer
  • Which functional characteristics of proteins distinguishes them from carbohydrates
    13·1 answer
  • DNA is considered the blueprint of life, yet in eukaryotic organisms, such as humans, it never leaves the nucleus. Which of the
    13·1 answer
  • What process occurs during transcription? (2 points)
    11·1 answer
  • Explain what you would have to do to the date on your watch if you were tocross over the International Date Line from east to we
    11·1 answer
  • Why did the color of the peppered moth change?
    9·2 answers
  • How do animals and other organism access glucose for cellular respiration?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!