Answer:
A concentration gradient occurs when the concentration of particles is higher in one area than another. In passive transport, particles will diffuse down a concentration gradient, from areas of higher concentration to areas of lower concentration, until they are evenly spaced.
Explanation:
Hope this helps c:
The South never again fought on Union soil.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
nice bed sheets
Explanation:
its A i just finished with that a few days ago a
Answer:
<u>Explore It #1</u>
1) There are <u>12 consumers</u> in this food web.
2) This food web had <u>2 producers</u>.
<u>Explore It #2</u>
1) The Greenfly eats the berries. The berries are eaten by a grasshopper.
2) The snake eats the frog. The frog eats the grasshopper.
<u>Explore It #3</u>
1) The Frog eats a dragonfly.
The Snake eats the frog.
The Ladybug eats the greenfly.
<u>Explore It #4</u>
1) A snake eats a lizard. The Owl eats a lizard.
2) A shark eats a tuna. The Blue whale eats a group of krill.
<u>Give Brainliest if you please</u>
