1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sp2606 [1]
3 years ago
8

When a person in the hospital is given fluid intravenously (an I.V.), the fluid is typically a saline (salt) solution with about

the same water concentration as human body tissues. Explain how the
use of distilled water in place of this saline solution would be expected to upset the patient's
homeostasis.
Biology
1 answer:
BaLLatris [955]3 years ago
3 0

Answer:

Distilled water is hypotonic with respect to the blood plasma of our body.

Explanation:

If distilled water is used in place of saline and injected intravenously then red blood cells of that patient"s body will start to swell as the osmotic pressure of the blood is very much greater than that of distilled water.

     That"s why, to maintain homeostasis 0.9% NaCl is used as saline solution because RBC is isotonic with 0.9% NaCl solution.

You might be interested in
Which of the following is relatively constant in an ecosystem? More than one answer may be correct!
ankoles [38]

Im pretty sure its

A. Number of Organisms

B. Amount of Matter

A million sorrys if im wrong :(

5 0
3 years ago
Read 2 more answers
where do plants get their energy from for photosynthesis to occur? water, sunlight, oxygen, or food(glucose)
vampirchik [111]

Answer:

Sunlight and Water

Explanation:

Plants can make food from absorbing sunlight

7 0
2 years ago
How are the hydrogen bonds in water responsible for many of the molecules unique characteristics?
DiKsa [7]

Hydrogen bonds exhibit the stronger intermolecular force, and water is a polar molecule, so the hydrogen bonding create strong forces which take more energy to break (causing the surface tension of water), and due to the polarity water molecules “stick” to one another which causes the edges to rise up in a tube, forming a meniscus

8 0
3 years ago
The activity of the enzyme β-galactosidase produced by wild-type cells grown in media supplemented with different carbon sources
Sliva [168]

Answer:

I am assuming that the mutant cells have mutated beta galactosidase activity hence the relative levels of enzymatic activity would be reduced.

7 0
2 years ago
Volume of Rectangular Prisms
Charra [1.4K]

Answer: It’s 2584

Explanation:

7 0
3 years ago
Other questions:
  • Machine generated alternative text: 11) process which requires the calculation of an interval size or the interval is
    7·1 answer
  • Which of the following statements does NOT relate to the nitrogen cycle?
    10·1 answer
  • How are transcription and translation related to the central dogma of molecular biology
    7·1 answer
  • Which of the following must be true in a dry limestone cave? Select all that apply. A. Water once entered the cave. B. The cave
    10·1 answer
  • What's the relationship between the temperature and the density of a substance?
    14·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Select all the correct answers.
    14·2 answers
  • How are babies made?
    10·1 answer
  • Which of The following substances below is match with its correct organic group: A)monosaccharides- nucleic acids B) DNA-lipids
    5·1 answer
  • --------- involves the reproduction of organisms best suited to their environment in greater numbers than the reproduction of le
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!