Answer:
The definition of an organism is a creature such as a plant, animal or a single-celled life form, or something that has interdependent parts and that is being compared to a living creature. An example of an organism is a dog, person or bacteria. An example of an organism is one party in the political organism.Types of Organisms. Scientists classify organisms into 3 domains and 6 kingdoms, although this has changed throughout history. There are 3 recognized domains, or broadest classification of organism. These are Bacteria, Archaea, and Eukarya.
Explanation:
For young students things are 'living' if they move or grow; for example, the sun, wind, clouds and lightning are considered living because they change and move. Others think plants and certain animals are non-living.You need a microscope to see them. They are called microorganisms. Organisms can be made up of just one cell. They are called unicellular organisms or single celled organisms. Examples include bacteria, and protozoa such as the Amoeba and Paramecium.
Just some things to know when you write your biography and a few examples, ~credits of info go to their owners~
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Bc it eats the waste that is inside of the sewer pipes
The answers include the following:
- The maps show that northern areas should get more precipitation, regardless of emission levels.
- Southern areas will likely get less precipitation, regardless of emission levels.
- These maps to prepare for natural disasters in the Great Plains, scientists need to ask how can we protect people and property in the event of a flood or a drought.
<h3>What is Drought?</h3>
This is referred to a period in which there is shortage of water due to reduced rainfall.
This leads to decrease in food production and the map patterns will help protect the people.
Read more about Drought here brainly.com/question/12686086
#SPJ1
