These mushrooms and other fungi will be classified as decomposers and they will obtain their nutrition by breaking down the body of organisms that have died. These organisms play a vital role in the cycling of nutrients in a food chain, since they convert the macromolecules present in dead organisms into smaller ones and release them back into the environment.
Answer:
transcription initiation
Explanation:
Transcription is a process by which genetic information from DNA is used to synthesize an RNA molecule, usually, a messenger RNA (mRNA), which is subsequently utilized to synthesize a protein by a process called translation. Transcription in prokaryotes has three steps:
1-Initiation: the RNA polymerase is a multisubunit enzyme (holoenzyme) composed of two α, one β, one β’ and one ω and σ subunits (α2ββ’ωσ). This holoenzyme binds to the promoter region of the template DNA strand.
2-Elongation. The sigma σ factor of the holoenzyme is released and the complex and the core enzyme (α2 ββω) moves along the template strand, thereby producing an mRNA sequence
3-Termination. This step can be Rho-dependent, where a protein named "Rho" recognizes the termination site and stop transcription, and Rho-independent (transcription continues until the termination sequence is reached).
In consequence, Rifamycin is likely to block the initiation of transcription because the core RNA enzyme needs to bind the sigma factor (σ) for initiation of transcription in bacteria.
Answer:
Yes, they are both active transport processes.
Explanation:
Exocytosis describes the process of vesicles fusing with the plasma membrane and releasing their contents to the outside of the cell. Both endocytosis and exocytosis are active transport processes.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
