1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
9

The image represents the structures found in a human bone. The cells which make up a bone are specialized to produce a substance

called osteoid which hardens to become the extremely dense and strong material that make up the bones of the human skeleton. What primary purpose is met by these specialized bone cells?
A) communication
B) control
C) reproduction
D) support

Biology
1 answer:
navik [9.2K]3 years ago
4 0
D) Support ...................
You might be interested in
Which is a difference between a compound light microscope and a transmission electron microscope? A.The compound light microscop
lapo4ka [179]

Answer:

While a light microscope uses light to illuminate specimens and glass lenses to magnify images, an electron microscope uses a beam of electrons to illuminate specimens and magnetic lenses to magnify images. The resolution (the level of image detailing) is the main difference between these two microscopes.

A compound light microscope is a microscope with more than one lens and its own light source. In this type of microscope, there are ocular lenses in the binocular eyepieces and objective lenses in a rotating nose piece closer to the specimen.

4 0
3 years ago
Read 2 more answers
What structures do organisms that lack cell walls have for support
Amiraneli [1.4K]

Answer:

Explanation:

plasma/cell membrane and cytoskeleton

3 0
3 years ago
How does human waste impact the carbon/oxygen cycle?
tester [92]
MORE carbon is released into the air, as a waste product
4 0
3 years ago
If the statement is true, write true. If the statement is false, replace the italicized word or phrase to make it true. 9. Penic
MariettaO [177]

Answer:

Each statement is followed by an indication for whether the statement is true or false and an explanation:

9. Penicillin is a drug that comes from a fungus. Another fungus is the source of antiheadache drugs for organ transplant patients.

The first part of this statement is true, penicillium is the fungus that produces penicillium. However, there isn't a record of antiheadache drugs being produced from a fungus for organ transplant patients, or otherwise for that matter.

10. People eat fungi such as truffles, mushrooms, and the yeast in bread. Fungi also give flavor to cheeses and soda drinks.

True. Not all types of fungi are harmful to us, there are several ways we take advantage of micro-organisms and this is just on example.

11. Respiration produces airy bread and the alcohol in beer and wine.

True. The yeast cells undergo aerobic respiration in case of making bread, it's the carbon dioxide they release that causes the bread to rise. During anaerobic respiration, the yeast cells produce alcohol - this process is also called as fermentation.

12. The use of fungi and bacteria to remove pollution is called enviroremediation

False. Environmental remediation is a general term for removing pollution in the environment. When bacteria and fungi are used to help in this process, it is referred to as <u>Bioremediation.</u>

<u />

Hope that answers the question, have a great day!

6 0
3 years ago
Which level of organization comes between a molecule and a cell? Question 3 options: Tissue Organelle Ecosystem Organism
erastova [34]
Organelle its organelle I think
8 0
3 years ago
Other questions:
  • Avery started feeding her dog canned food two months ago. At first, when she opened the can of food, her dog was confused by the
    10·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Between Mary's and Amy's organisms, which one would likely share a stronger evolutionary lineage with your organism?
    9·1 answer
  • Bacteria, viruses, fungi, and protists have a bad reputation. People focus on the diseases they cause, the food they rot, and th
    8·1 answer
  • What is most likely the reason the author included the description of the spoon in the hot coffee cup?
    14·1 answer
  • Too much calcium in a person's diet may result in
    8·1 answer
  • Based on the above graphic.
    12·1 answer
  • Plants,protists,animals and fungi are made up of cells. true or false?​
    9·2 answers
  • Which statement best describes why the guard cell and the storage parenchyma cell are different?
    10·1 answer
  • Why is it important to balance the rate of extraction of water from an aquifer with its rate of recharge?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!