1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nostrana [21]
3 years ago
6

Where are collar cells located and what are two functions of these specialized cells

Biology
1 answer:
Mekhanik [1.2K]3 years ago
8 0

Answer:sponge

Explanation:

Collar cells have a sticky funnel-shaped collar and a hair-like whip that is called the flagellum. A cell called an amebocyte takes the food picked up by a collar cell to other cells within the sponge. Collar cells are also called choanocytes

You might be interested in
Which organ produces estrogen and progesterone
Katena32 [7]
Follicle<span>-stimulating hormone </span>
4 0
3 years ago
Read 2 more answers
Write and balance the cellular respiration equation of glucose (C6H12O6). Compare it with the photosynthesis reaction in terms o
Elanso [62]

Answer:

6O2 + C6H12O6 --> 6CO2 + 6H2O + ATP energy

and the photosynthesis reaction takes the opposite only it's input is sunlight energy

without either we are all dead

they are complimentary

Explanation:

3 0
3 years ago
​Approximately what percentage of the body's energy needs at rest is supplied by fat
Ilya [14]
<span>The percentage of energy provided by fat when the body at rest is around 60%. The remainder of the energy provided to the body is from other nutrient sources, proteins and carbohydrates. The body uses these calories at rest for regular functions- respiration and other normal bodily processes.</span>
4 0
3 years ago
Please help me with this
slavikrds [6]

Answer:

1.D 2. i  

Explanation:

7 0
3 years ago
Help me, please and thank you
iragen [17]
1. A , 2. D, 3. A , 4.C , 5. B , 6.A
8 0
3 years ago
Other questions:
  • 11. What is biotic potential?
    7·1 answer
  • Why do individual water masses within the oceans retain distinctive physical properties for long periods?
    15·1 answer
  • Amphetamine increase synaptic levels of serotonin because: a. it increases the activity of the VMAT b. it blocks COMT c. it incr
    7·1 answer
  • Why is pseudoscience not considered real science ?
    10·2 answers
  • PLZ HELP!!!! urgent. question is on the picture. I will mark whoever answers first brainliest . PLZ help!!!! urgent
    7·1 answer
  • Use the drop-down menus to complete the statements.
    12·2 answers
  • What are the causes of soil compaction? (Site 1)
    12·1 answer
  • Which of these describes a difference between viruses and cell
    9·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • If you ate a spoonful of peanut butter for breakfast, the majority of the energy would come from the ________in the peanut butte
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!