1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lera25 [3.4K]
3 years ago
11

Evan finds a rock while hiking. It has a fossil in it. The rock is most likely a(n) _____.

Biology
2 answers:
telo118 [61]3 years ago
5 0

Answer:

sedimentary

Explanation:

statuscvo [17]3 years ago
3 0
Sedimentary would be correct because fossils are formed by the burial of sediments!
You might be interested in
- Which is an advantage to biomass energy? *
KATRIN_1 [288]

Answer:

D. There will always be waste produced that can be used for energy.

Explanation:

Biomass energy is a renewable energy source because its does not have limited supply. We can always grow trees and crops, and waste will always exist.

7 0
3 years ago
Read 2 more answers
What percentage of the offspring will express the dominant trait?
Ipatiy [6.2K]

Answer:

it is 25%

Explanation:

for a parents to be transmitted

4 0
2 years ago
one important difference between living things (biotic) and nonliving things (abiotic) is that only living things have
Mamont248 [21]
The answer is: D. Cells
7 0
3 years ago
Read 2 more answers
In which domains are ALL the organisms unicellular?
tamaranim1 [39]

Answer:

A

Explanation:

4 0
3 years ago
Read 2 more answers
_________7. During strenuous exercise, skeletal muscles use up ___________ and produce large amount of ________, which causes pa
DanielleElmas [232]

Answer:

A. Oxygen, lactic acid

3 0
3 years ago
Other questions:
  • A traveler finds herself in a biome that is full of trees. She notices that there are many
    15·1 answer
  • This chart presents data on greenhouse gas emissions caused by human activity from 1990 to 2012. Which questions would help clar
    8·2 answers
  • A grouping of stars that resembles a picture
    11·2 answers
  • 56:19
    6·1 answer
  • A plant that grows in water
    11·2 answers
  • The decimal reduction time (DRT) to kill 90% of cell present for autoclaving a culture is 1.5 minutes. How long would it take to
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • How does the circulatory system work at the organ level?
    14·2 answers
  • 7. Explain why there is a difference in the amount of oxygen taken in at rest and during the vigorous activity, (2​
    9·2 answers
  • Which stem adaptation is most helpful in protecting a plant from disease
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!