Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
the internal organ in which the major part of the digestion of food occurs, being (in humans and many mammals) a pear-shaped enlargement of the alimentary canal linking the esophagus to the small intestine.
Answer:
plasmolysis is the shrinkage of protoplast from the cell wall under the influence of a hypertonic solution.this can be observed by placing the fresh filament of spirogyra in a 10% solution of common salt.the cell undergoes exomosis.
I hope this helps
Most of the mutations have no effects whatsoever on the organisms but some can be dangerous. There are two types of mutations that cause harm to the organism's ability to survive:teratogen muations are the mutations that form inside the uterus when the fetus is still developing and can even kill it or cause severe malformations that lead to death in the early life. Carcinogen mutations are the ones that lead to the formation of neoplasms(masses of cells that divide uncontrollably, basicly cancer).
<span>The American Academy of Pediatrics recommends that all </span>babies<span> receive </span>vitamin D<span> supplementation (400 IU per day) due to decreased sunlight exposure and an increase in rickets.
Babies need this due to lack of sunlight exposure and is highly recommended if they're breastfed.</span>
