The ocean is a carbon sink, with carbon being utilized by photosynthesis of phytoplankton describes the availability of carbon in the ocean and its use by marine processes
The ocean is a carbon sink, with carbon being utilized by photosynthesis of phytoplankton.
<u>Explanation:</u>
The carbon is found in the ocean is utilized by the phytoplankton found in the ocean. The carbon sinks in the ocean and then the process of photosynthesis required the carbon dioxide and the sunlight.
The ocean plays an important role in the carbon cycle, the carbon spreads in the ocean are called the ocean sink because it takes up more carbon from the atmosphere. The chemical and biological processes influence the carbon by producing more carbon dioxide in the atmosphere.
Answer:
False
Explanation:
Exercising an American call option on a stock with non –dividend provides greater interest or saving on interest as compared to holding those call option.
In general, An American call can be exercised any time prior to its expiry time limit. In case of an American call on a stock with dividend, early exercise before the expiry is optimal. Early exercise also provides for in depth money options.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
The process that brings energy to the biosphere is PHOTOSYNTHESIS.
Photosynthesis is the process by which energy from the sun is trapped and used to produce food by plants. During photosynthesis, carbon dioxide and water react together in the chloroplast in the presence of sunlight to form starch and oxygen. Oxygen is the by product of the reaction. The energy from the sun is stored inside the starch molecule in form of chemical energy and this energy is made available to the animals when they consume the produced starch. Thus, photosynthesis is the source of all energy in the biosphere.
