1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alika [10]
4 years ago
11

An injury to the nervous system results in nervousness and hyperactivity. Which division of the nervous system was damaged by th

e injury?
Central
Sympathetic
Sensory somatic
Parasympathetic
Biology
1 answer:
Damm [24]4 years ago
6 0
<span>Central nervous system
Sympathetic nervous system

The neuron, a cell that composes the nervous system. For example a brain, an organ composed of thousands of neural fibers and glial cells that performs many important organismic functions. </span>
<span>Neurons are specialised cells that have dendrites, axons and terminal buttons that sends and receives stimuli from the environment and transduces it into a meaningful information and understand the complexities which the brain now functions.<span>
</span></span>
You might be interested in
The diagram shows a food web.
-Dominant- [34]

Answer:

grass

Explanation:

grass produces the main source of energy for the food chain

5 0
4 years ago
Describe how the picture below represents the function of the immune system
Oksanka [162]

Answer:

The Human Immune system helps fight bacteria and germs and viruses because without the Immune system we could die it is what protects us from The flu and sometimes cov id with a weak immune system we might no survive.

Explanation:

4 0
3 years ago
Which of the following is NOT a natural resource?
Shalnov [3]

Answer:

D

Explanation:

Fire is man made because for there to be fire you have to strike a match or use other man made sources

4 0
3 years ago
How do you know if a trait on a pedigree is recessive?
Reika [66]
An easy way to tell is if the trait is or isn’t in every generation. If a trait skips a generation, it’s most likely recessive.
5 0
3 years ago
Which of the following is NOT a feature of cardiac muscle fibers?
Andreyy89

Answer:

(1)They are usually multi-nucleated.

Explanation:

Cardiac muscles are one of the three muscles found in the human body (the other two being skeletal and smooth muscles). It is the only type of muscle found in the heart. Cardiac muscle cells have a single nucleus unlike the skeletal muscle cells.

They possess many large mitochondria in their cell, which enable them actively carry out the process of aerobic respiration. The cardiac muscles contains an enormous amount of myoglobin pigment, which enable them store and transport oxygen. Due to the high glucose in its cell, excess glucose is readily stored as Glycogen, making it rich in glucose.

Based on the explanation, being MULTI-NUCLEATED is not a feature of cardiac muscle fibers.

8 0
3 years ago
Other questions:
  • Can you label the structures involved in the endosymbiotic origin of mitochondria and chloroplasts?
    5·1 answer
  • A liver cell must create a protein to carry fats through the body. Where would the instructions be found?
    6·2 answers
  • Match the term with the most appropriate definition.
    6·1 answer
  • The retreat of the shallow seas of the Paleozoic left much of Virginia exposed during the Permian and Mesozoic. In central Virgi
    11·2 answers
  • 1. Nutrients move from the digestive system into the blood by traveling through ___________, tiny tubes sticking out of the wall
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Biome home to enormous herds of grazing animals, has distinct rainy season and dry seasons as well as high average temperatures,
    12·1 answer
  • A new car is being built in a factory. One of the factory workers weighs all the parts before it is built. It weighs 2,300 pound
    8·1 answer
  • Purchasing through a mobile phone is called .
    5·1 answer
  • Please answer the questions circled (with stars)
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!