1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scrat [10]
2 years ago
8

The average age at which an infant can sit unattended is approximately __________ months.

Biology
2 answers:
Alika [10]2 years ago
7 0
This varies from baby to baby, but it is approximated to be the ages of 4 to 7 months.
vova2212 [387]2 years ago
6 0

Answer:

5-7

Explanation:

You might be interested in
Snow owls prey on lemmings in their arctic habitat, and their survival is closely linked to the abundance of lemmings. In years
Rama09 [41]

Answer: A scarcity of lemmings will cause for the population of snowy owls to decrease, as their resources have been limited.

8 0
2 years ago
What is mega biodiversity ?
Musya8 [376]
<span>the variety of life in the world or in a particular habitat or ecosystem.       
examples would be like a group of animals living on a farm or a family in a house.
but if ur meaning "megadiverse"     would be like humans inhabiting the earth.   or the ocean full of marine life</span>
3 0
3 years ago
Explain why society has been developing different renewable resources in favor of
Angelina_Jolie [31]

Answer: Society has been developing different renewable resources in favor of nonrenewable sources in the past decades because natural gas and oil has been used to much that we are running out of nonrenewable sources. So society has been trying to use solar panels, wind panels, and water.  

Explanation:

3 0
3 years ago
I will mark you has brainliest ​
brilliants [131]

Answer:

C

Explanation:

7 0
2 years ago
What is the best description of sexual reproduction in plants?
ddd [48]

It's B. I just took the quiz.

3 0
3 years ago
Read 2 more answers
Other questions:
  • What is water’s role in the light reaction of photosynthesis?
    15·2 answers
  • D.One year
    12·1 answer
  • The federal pure food and drug act of 1906 defined an adulterated drug as a drug that
    13·1 answer
  • What are three solutions that the USDA and EPA have proposed to help improve the health of honey bee colonies?
    12·1 answer
  • When a cell divides by mitosis the new cells are genetically identical. What causes the cells to be genetically identical?
    5·2 answers
  • A slow moving stream has many plants growing changes to the climate make the water in the stream move faster. What is the most l
    10·1 answer
  • During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleot
    9·1 answer
  • What is a disadvantage of the circuit pictured to the right? (10b;DOK 1) A. The addition of more light bulbs decreases the flow
    8·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Do you wanna go plant tulips with me
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!