1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inn [45]
3 years ago
15

A long, tightly coiled molecule that looks like a twisted zipper inside a cell's nucleus

Biology
1 answer:
garik1379 [7]3 years ago
7 0
The answer to this question is Gene 
You might be interested in
16. The substances that are reabsorbed did not diffuse (move) from the nephron bowl into the
SpyIntel [72]

Answer:

Active transport.

Explanation:

The kidney uses active transport  to move these substances from the nephron to the  renal vein because these substances did not moves from the nephron bowl to the renal vein through simple diffusion so for this purpose active transport is used in which energy is spent in order to move the substances from one region to another so we can say that kidney must use active transport to move reabsorbed substances from the nephron to the  renal vein.

4 0
2 years ago
Lactose a sugar found in milk products is broken down by enzymes. The making of these enzymes is controlled by a genetic system
GrogVix [38]
I think the answer is replication
6 0
3 years ago
Is cancer genetic/hereditary?
photoshop1234 [79]

Answer:

it's may be genetic.

<h2>hope it helps.</h2><h2>stay safe healthy and happy.</h2>

5 0
2 years ago
Read 2 more answers
Red-green color blindness is an X-linked recessive disorder that is passed through generations and can be traced by using a pedi
OlgaM077 [116]
B. Sam, Tim, Bella, and Joshua
8 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Name three social benefits provided by biodiversity.
    14·2 answers
  • What does a fart really smell like?
    8·2 answers
  • DNA is made of nucleotides which are composed of
    9·2 answers
  • Both mitochondria and chloroplasts _____. both mitochondria and chloroplasts _____. reduce nad+, forming nadp use an h+ gradient
    10·1 answer
  • How do you use relative dating in a sentence
    6·1 answer
  • The presence of paired chromosomes makes a diploid/germ/haploid/gamete cell, while a single member of a pair of chromosomes make
    12·1 answer
  • Proposed the polynucleic model, stating that DNA and RNA were composed of nucleotides
    15·1 answer
  • ________________________ is without symmetry.
    13·1 answer
  • Pls help need this for a class
    5·1 answer
  • The study of the cells in gastric pits is an example of.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!