1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tresset_1 [31]
3 years ago
14

Mathematically, the biomass in the ocean contributes __________ times more grams of npp per year per gram than an equivalent gra

m of plant biomass in a terrestrial ecosystem.
Biology
1 answer:
svetlana [45]3 years ago
8 0

Answer;

-Over 4000

Mathematically, the biomass in the ocean contributes over 4000 times more grams of NPP per year per gram than an equivalent gram of plant biomass in a terrestrial ecosystem.

Explanation;

-Living biomass forms a tiny fraction of Total Ocean carbon but has a very significant influence on the ocean carbon cycle. Every gram of biomass of the primary producers in the ocean contributes more to NPP per year than plant biomass of terrestrial ecosystems.

-In marine ecosystems, phytoplankton is the main source of primary production. The nutrient availability cycles make it important to distinguish between new and regenerated primary production ; the former identifies the annually renewed nitrogen, while the second measures the rapid cycling of nitrogen through ammonia availability.

You might be interested in
Which type of rock is marble?
Elodia [21]

Answer:

Metamorphic rock is marble type of rock

4 0
2 years ago
Read 2 more answers
why animals that live in your area might be found in greater or smaller number than in other places on earth
Airida [17]
Because some animals thrive better in different locations
4 0
4 years ago
Which of the following indicates that all organisms can be traced back to a common ancestry?
BaLLatris [955]

Answer:

The genetic material's inheritability shows how that the DNA of all creatures, both living and dead, can be traced back to a single point, which is our common ancestral origin of life.

Explanation:

5 0
3 years ago
This serves as a quick energy source.
aivan3 [116]
Maybe protein not too sure
5 0
3 years ago
A cultured cell line appears to be having trouble surviving. You find that the cells do not appear to have normal chromosome sep
goldenfox [79]

Answer:

c. Tubulin

Explanation:

Tubulin protein is polymerized to form the cylindrical structures of microtubules. Microtubules form the spindle apparatus during cell division. The spindle microtubules become attached to the kinetochores of chromosomes and mediate the alignment of chromosomes at the equator of cells during metaphase. The shortening of spindle microtubules is responsible for the movement of sister chromatids during anaphase. The same event also moves the homologous chromosomes during anaphase-I.

Any failure in the formation of the spindle apparatus would not allow the proper separation of chromosomes. Therefore, the cell with abnormal chromosome separation might have a faulty or no tubulin.

6 0
4 years ago
Other questions:
  • Which condition is required for viruses to reproduce?
    10·2 answers
  • Describe how the availability of genetic sequencing can affect the frequency of genetic diseases in individuals and populations.
    6·2 answers
  • In the boxes, write the number of crickets you would test to make this a controlled experiment
    13·2 answers
  • What group of organisms is simplest, without nuclei?
    5·2 answers
  • True or false Carbohydrates are made up of amino acids.
    15·1 answer
  • Suppose you discovered a mutant strain of spinach in which the thylakoid membranes were slightly permeable to protons, thus allo
    11·1 answer
  • Explain the difference between the term evolution and<br> biological evolution?
    6·1 answer
  • Which organic molecule Holds directions<br> to make proteins
    13·1 answer
  • What makes a compound different than a mixture
    6·1 answer
  • You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATT
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!