Answer:
B
Explanation:
All the other problems are caused by external factors, or outside events
Answer: a. Fallacy which compares minor misdeeds with major atrocities
Explanation:
The Moral equivalence logical fallacy refers to a scenario where the moral actions of different people are considered equivalent simply because of similarities they might have in terms of where they fall on the morality spectrum (right or wrong) regardless of the scale of the actions.
It can therefore lead to one comparing minor misdeeds with major atrocities. For instance: ''Did you just kill a cockroach? You're such a Jack the Ripper.''
Answer:
By applying Chargaff's rule, which states that A only bonds with T and C only bonds with G in a DNA strand. One other factor that makes the rule true is because of the presence of hydrogen. Hydrogen ensure the bonding between the bases which holds the DNA Strands together.
Explanation:
By Applying Complementary Base-Pairing Rules, Let's say you have a DNA sequence of a specific gene on one strand of DNA. You can then use complementary base pairing rules to figure out the other DNA strand that makes up the DNA molecule. For example, let's say you have the following sequence:
AAGGGGTGACTCTAGTTTAATATA
You know that A and T are complements of each other and C and G are complements of each other. That means the DNA strand that pairs with the one above is:
TTCCCCACTGAGATCAAATTATAT
Use the rule and example and fill in the table.
I belive for the first one it is A. And for the second one I have no idea honestly.