<span>This view led individuals and businesses to disregard these areas as unimportant and therefore they served as prime locations for dumping and pollution. This dumping and pollution led to the further degradation and destruction of these vital natural habitats.</span>
Blue-green algae affect freshwater, and it has a direct correlation to agricultural and urban runoff.
The heavy rains last spring most likely caused Lake Okeechobee to discharge water containing blue-green algae into rivers and canals. The bright green sludge oozed onto docks, dams and rivers and through tributaries into the ocean.
Blue-green algae (cyanobacteria) are a group of prokaryotic, autotrophic microorganisms that contain the photosynthetic pigments (chlorophyll and phycocyanin), Therefore, the DNA shows bacteria
Bacteria is the correct answer
Underneath the right side of the liver, the gallbladder is a pear-shaped organ.
<h3>
What is the function of gall bladder?</h3>
Its primary function is to gather and concentrate bile, a digestive fluid made by the liver. The gallbladder is where bile is kept after the liver produces it. The gallbladder receives a signal from the stomach when you eat. Bile is released from the gallbladder when it contracts, and it travels through the gut via the major common duct. Bile combines with the food there and aids in digestion.
When the gallbladder is removed from a healthy person, there are rarely any obvious health or digestive issues, though there is a slight chance of diarrhea and fat malabsorption.
For more information regarding gall bladder, visit:
brainly.com/question/4280987
#SPJ1
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
