1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
snow_lady [41]
3 years ago
7

6. What is produced from the third stage of cellular respiration, the electron transport chain? (2 points)

Biology
2 answers:
kati45 [8]3 years ago
5 0
It produces water and ATP
tankabanditka [31]3 years ago
3 0

B. Water and ATP

A. NADH

You might be interested in
What do you mean by environmental degardation?​
sashaice [31]

Answer:

if you mean environmental degradation it is where the environment deteriorates(gets worse).

Explanation:

this happens through lack of air,water and soil, destruction of ecosystems and habitat destruction

5 0
3 years ago
Read 2 more answers
One of the functions of the ozone layer within our atmosphere is to...
grandymaker [24]

Answer:

B. Protect us from harmful ultraviolet Radiation.

Explanation:

I did this in 6th grade. The ozone layer contains a high concentration of ozone, which absorbs most of the ultraviolet radiation reaching the earth from the sun.

8 0
3 years ago
What Is Science? Own Answer<br>Please I need it✨​
lozanna [386]

Answer:

science is the study of the physical world by observation for the purpose of understanding the world

3 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Fragmenting one large park or preserve into many small parks with human habitation in between them is most likely to lead to whi
barxatty [35]

Answer:

The correct answer is a. Reduction in species diversity

Explanation:

In habitat fragmentation, the large area of forest is divided into many smaller patches which reduce the area of habitat for species live there. This Fragmentation of habitat occurs mainly due to human activities like making highways and roads in the area.

This separates species member from each other which reduces the gene flow between that which can lead to inbreeding depression in a species and extinction of species can occur.  

Cutting trees and human activities can alter the environment negatively which can cause extinction of some species that reduce species diversity. So the correct answer is a.

3 0
3 years ago
Other questions:
  • Which of the following best predicts the most direct effect of exposing prokaryotic cells to streptomycin?
    9·1 answer
  • 2 Points
    15·1 answer
  • Do any of the proteins in your plasma come from food proteins
    10·1 answer
  • You are trying to cook a pot of soup on the stove. As you watch the pot you notice that the noodles inside begin to rise to the
    6·1 answer
  • Which type of radiation from the Sun has the greatest potential to harm human skin?
    13·1 answer
  • [QUIZ]Lvl 1<br><br> Is it true that all living things are made up of two or more cells
    10·2 answers
  • When the cell duplicates chromosomes and separates into two separate nuclei, the cell is said to be in what phase?
    11·1 answer
  • What protects Earth's surface?
    15·1 answer
  • Researchers are studying the last two phases of mitosis, anaphase and telophase, in actively dividing cancer cells. Different fl
    8·1 answer
  • Why do living things need air to breathe?<br>​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!