1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katena32 [7]
3 years ago
5

Why is it not totally suprising that animals can suffer from emotional distress orental illness​

Biology
1 answer:
choli [55]3 years ago
3 0

Answer:

because we can to so we really dont think about it.... also WE ARE ANIMALS!

Explanation:

You might be interested in
Consider the following: Succinate dehydrogenase catalyzes the conversion of succinate to fumarate. The reaction is inhibited by
makkiz [27]
B. is the answer dude
8 0
3 years ago
How does the light reaction of photosynthesis affect earth's supply of oxygen?
BabaBlast [244]

Answer:

It releases carbon dioxide and decreases Earth's supply of oxygen. It absorbs oxygen, thus decreasing Earth's oxygen supply

Explanation:

4 0
3 years ago
The offspring will have traits from both the father and the mother
kvasek [131]
If it's a true or false question it's true.
6 0
4 years ago
Read 2 more answers
If you see a cell with blue fills of varying lengths representing the values, the cells most likely have ________ applied to the
ioda

When a person  see a cell with blue fills of varying lengths representing the values, the cells most likely have data bars applied to them.

<h3>What are Data bars?</h3>

Data bars are known to be a kind of  conditional formatting that alters based on the data that is said to been shown.

The bigger the number, the fact still remains that the  longer the bar that appears in a cell. They often do look like an advanced feature but they are said to be easier to input the data bars to a spreadsheet in Excel using few clicks.

Learn more about data bars from

brainly.com/question/26465374

8 0
2 years ago
Please help me please!!!​
pantera1 [17]

Answer:

  1. nasal cavity
  2. pharnys
  3. laryns
  4. lung
  5. right bronchi
  6. diaphragm
  7. mouth cavity
  8. trachea
  9. left brochi
  10. bronchiole
  11. alveoli
5 0
3 years ago
Other questions:
  • When a plant is not strong enough to support its own weight?
    12·2 answers
  • When bacteria are inoculated into a new sterile nutrient broth, their numbers don’t begin to increase immediately. Instead, ther
    9·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which of the following structural adaptations helps an organism obtain food?
    14·1 answer
  • 6. Factors that increase the amount of mutations<br>are called ....​
    10·1 answer
  • Explain how a rollercoaster converts potential energy to kinetic energy
    9·1 answer
  • What does passive transport mean
    10·1 answer
  • 4. If the rock sample contains 20 mg of tritium 3, how much<br> will remain after 48 years?
    11·1 answer
  • Two lizards with different coloring exist within the same ecosystem. One lives in the trees, and the other prefers hiding among
    6·1 answer
  • How does an enzyme affect the rate of the<br> reaction?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!