1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
QveST [7]
2 years ago
7

In bacterial cell division, the cell divides into two nearly equal halves. This process is referred to as:

Biology
1 answer:
Step2247 [10]2 years ago
5 0

In bacterial cell division, the cell divides into two nearly equal halves. This process is referred to as mitosis.

To answer the question, we need to know what cell division is

<h3>What is cell division?</h3>

This is the process in which parent cells divide into two or more daughter cells.

There are two types of cell division namely

  • Mitosis and
  • Meiosis
<h3 /><h3>Mitosis</h3>

Mitosis is the process in which non-reproductive (somatic) parent cells divide into two daughter cells that have the same number of chromosomes as the parent cell.

<h3>Meiosis</h3>

Meiosis is the process in which reproductive parent cells divide into four daughter cells with half the chromosoes of the parent cells.

From this, we see that cell division in which the cell divides into two nearly equal halves is refered to as mitosis.

So, in bacterial cell division, the cell divides into two nearly equal halves. This process is referred to as mitosis.

Learn more about cell division here:

brainly.com/question/14439902

You might be interested in
The hydrilla, a non-native species of the Hudson River Estuary, has begun to grow along the surface of the water and spread thro
Nutka1998 [239]
The right answer for the question that is being asked and shown above is that: "The hydrilla is an invasive species, and its presence will have an overall negative effect on the estuary." This is the statement that<span> is true of the hydrilla growing in the Hudson River Estuary.</span>
6 0
3 years ago
I'll give you a brainliest if is right or at least shows some effort
insens350 [35]

Answer:

Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.

I tried my hardest and this is what I put on MY test so good luck

4 0
3 years ago
Match the term with the definition.
maria [59]

Answer:

1.tissue

2.organ system

3.organ

4.cell

5.tissue

Explanation:

1.Tissues are groups of similar cells that have a common function. An organ is a structure that is composed of at least two or more tissue types and performs a specific set of functions for the body. Many organs working together to accomplish a common purpose is called an organ system.

2.Tissues are groups of similar cells that have a common function. An organ is a structure that is composed of at least two or more tissue types and performs a specific set of functions for the body. Many organs working together to accomplish a common purpose is called an organ system.

3.Cells grouped together to perform a specialized function are known as a tissue. Tissues arranged together to perform a special function are known as an organ. Organs that together to perform the many functions of the body as a whole are called a system. ... Any abnormal development of tissues or organs.

4.Molecules are the chemical building blocks of all body structures. A cell is the smallest independently functioning unit of a living organism.

5.Tissue. Word used to denote a living thing. Organism. Level made up of a group of tissue working together. Organ.

6 0
3 years ago
What part of the respiratory system is composed of a single layer of epithelial tissues surrounded by a network of capillaries?
svetlana [45]
I think the correct answer from the choices listed above is option A. It is the alveoli that is composed of single layer <span>surrounded by a network of capillaries. These are used to allow oxygen and carbon dioxide to move from the lungs to the bloodstream.</span>
6 0
4 years ago
Read 2 more answers
Please help very easy 5th grade work giving brainliest
strojnjashka [21]

Answer:

pretty sure its A hope this helps!

8 0
3 years ago
Read 2 more answers
Other questions:
  • What makes DNA evidence unique? Be specific.
    15·2 answers
  • What happens to food energy during photosynthesis? during cellular respiration??
    11·1 answer
  • What is the process by which cells link monomers together to form polymers??
    9·1 answer
  • A lipid that the body requires to make several critical substances but can’t synthesize on its own is _____.
    5·1 answer
  • Explain how the function of meiosis differs from the function of mitosis
    10·1 answer
  • What are 3 structures are found in every living cells?
    9·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • For the past 2 years, a client has had increasing difficulty remembering the events of the day, but has been able to recall even
    12·2 answers
  • What structure is formed during the unwinding process of replication?
    13·2 answers
  • HELP PLEASEEEE ASAP.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!