1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastasy [175]
3 years ago
6

BEST ANSWER=BRAINLIEST why is the digestive system necessary for the body’s health?

Biology
1 answer:
alexgriva [62]3 years ago
5 0
The digestive system is necessary for the body's health because it breaks down the food we eat into small pieces that can be absorbed by the body. Without the digestive system, we would not receive all of the nutrients from food.
You might be interested in
This is an organism or cell with two sets of chromosomes.
butalik [34]
The sex cell has two sets of chromosomes
7 0
3 years ago
Read 2 more answers
The thin, yellowish milk secreted in the few days right after birth is rich in antibodies and immune system cells. Group of answ
Damm [24]

Answer: The statement is TRUE.

Explanation:

The thin, yellowish milk which may appear at any time from late pregnancy to few days right after birth is known as Colostrum milk.

During pregnancy, progesterone and oestrogen cause the milk glands to develop in the mother's breast. Immediately after birth, the anterior lobe of the pituitary releases a hormone, prolactin, which stimulates milk production. When the baby suckles at the mother's nipples, the milk flows out.

This first yellowish milk known as colostrum, contains all the essential nutrients that a newly born baby needs. It also provides antibodies and immune cells that protect the infant from disease. The milk is rich in protein and fats than normal milk. It is the first immune system defense they receive after birth. Therefore the above statement about the first thin yellowish milk is TRUE.

3 0
2 years ago
What kind of map is a rectangular representation of earth but she was accurate directions but distorts the sizes and distances
Anna [14]

The correct answer is - Mercator projection map.

The Mercator projection map is a cylindrical type of map that represents the Earth in rectangular manner. While the map may seem as a nice representation of the Earth, and it has accurate directions, it also has some flaws. The biggest flaw of this map is the distortion of the sizes. The distortion is non existent on the Equator, but as it moves north and south of it towards the poles, the distortion is constantly increasing. This projection is not made to be able to cope with the increase of the scale, especially when it it is infinite at the poles.

Because of this, on this map, Greenland looks very similar in size with Africa, even though in reality it is around 15 times smaller.

8 0
3 years ago
Food handlers are not allowed to wear fingernail polish while handling food with bare hands unless _____. they are wearing glove
Archy [21]
The statement above is TRUE. Food handlers are expected to keep their nails short and trimmed; this is because the microbes under nails can be a great hazard to the food that is been prepared. Food handlers are not expected to wear nail polish or put on artificial finger nails and if they do, they must put on single use gloves.
3 0
3 years ago
Because of global climate change, arctic landscapes and ecosystems are changing rapidly and perceptibly, as the residents of New
olasank [31]

Answer:

The correct answer is D)

Decades ago, the U.S. government mandated that they and other Alaskan natives abandon a nomadic life based on hunting and fishing for sedentism.

Explanation:

Sedentism is simply the practice of settling in one geographical location for a long time.

Many governments encourage this to ensure that agricultural systems become developed and more sustainable as was the case in Alaska.

Other governments in some part of the world are also in support albeit for a different reason such as security of lives and property.

Cheers

7 0
2 years ago
Other questions:
  • In which of the following ways is DNA replication different from DNA transcription?
    9·1 answer
  • The endocrine system works by secretion of one or more chemicals called _______
    7·2 answers
  • Which region of the operon does the repressor bind to?
    14·1 answer
  • How do you get a boy to like you
    7·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Question 10 (1 point) Which feature is unique to Earth? Question 10 options: the hydrosphere solid water (ice) liquid water wate
    8·1 answer
  • Help! two quick questions!
    14·1 answer
  • What are the parts of the pistil and the stamen? Which is male, which is female?
    6·1 answer
  • A STUDENT WANTED TO INVESTIGATE THE MOVEMENT OF WATER INTO AND OUT OF CELLS IN POTATOES
    13·1 answer
  • Dr. Vial has a vile weapon (note the play on words) that destroys plasma membranes.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!