1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexxandr [17]
3 years ago
15

1. You are studying glycolysis in a cell free extract of muscle and you find that, in an oxygen-free atmosphere, the extract eff

iciently converts glucose to lactate. You then do an experiment in which you add an inhibitor, oxamate, to the extract in addition to glucose. You find that fructose-1,6-bisphosphate, dihydroxyacetone phosphate and glyceraldehyde-3-phosphate accumulate to high concentrations, while 1,3-bisphosphoglycerate, phosphoenolpyruvate and pyruvate are at very low concentrations.
Based on the result of this experiment, what enzyme do you think is inhibited by oxamate?
Biology
1 answer:
BigorU [14]3 years ago
3 0

Answer:

Glyceraldehyde-3-Phosphate Dehydrogenase

Explanation:

Glyceraldehyde-3-Phosphate Dehydrogenase is responsible for the formation of 1,3-bisphosphoglycerate, which is then catalyzed to yield phosphoenolpyruvate by pyruvate kinase.

You might be interested in
Which piece of evidence, if discovered, would most directly contradict the current model for how Earth’s oceans and atmosphere f
VashaNatasha [74]

Answer:Water covers about 70 percent of the Earth's surface, but where did it come ... These two pieces of evidence would favor an asteroid origin.

Explanation:

3 0
3 years ago
How many feet of intestines does the average person have
iogann1982 [59]
Research suggest that the combined length of the small and large intestines is at least 15 ft in length. The small intestine can measure about 9-16 ft while the large intestine is roughly 5ft long.
5 0
3 years ago
(10 points) One of the accepted scientific theories describing the origin of life on Earth is known as chemical evolution. Accor
vodomira [7]

Answer:

Synthesis of organic molecules

Explanation:

8 0
3 years ago
Generally, an ultrasound is performed for all women at this point. The fetus can suck its thumb, yawn, stretch, and make faces.
ivolga24 [154]
Yes this is true a baby can show that in a ultrasound
4 0
4 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Temperature is an important physical feature of an ecosystem. which option below shows a correct, direct relationship between te
    5·1 answer
  • Sherri has recently been injured. She is having a problem using her left hand and would like to use a stylus to move her mouse a
    5·1 answer
  • What are some of the human activities that threaten the world's largest surviving regions of rain forest?
    10·2 answers
  • Long-term studies of certain species of squirrels in California revealed that some of the quirrels move nearly two kilometers fr
    11·1 answer
  • The drug cytochalasin targets actin filaments in the cytoskeleton, preventing them from forming. Treatment of a cell with cytoch
    10·1 answer
  • Which temperature listed below allows for the greatest rate of photosynthesis? Use the graph below to determine the answer.
    11·1 answer
  • How can the geosphere affect the atmosphere?
    9·2 answers
  • PLEASE HELP!!!
    8·1 answer
  • What would happen if your heart valves stopped working?
    5·1 answer
  • Does anyone get how to do this? I’m kinda stuck (picture provided)
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!