1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Charra [1.4K]
3 years ago
7

Pressure increases as depth,________? No answer choice

Biology
2 answers:
lorasvet [3.4K]3 years ago
7 0
Pressure increases as depth, increases. (I assume you are talking about a body of water.)
Flauer [41]3 years ago
5 0
Pressure increases as depth increases (:
You might be interested in
Definition: A thin, flexible, semipermeable barrier around the cell which regulates what enters and leaves
Anettt [7]
It’s a cell membrane
3 0
3 years ago
How does the phrase "lock and key" apply to enzymes?
Bumek [7]

Answer:

its b i think

Explanation:

3 0
3 years ago
How does the organ level of organization relate to cells and organ systems
salantis [7]

Answer:Higher levels of organization are built from lower levels. Therefore, molecules combine to form cells, cells combine to form tissues, tissues combine to form organs, organs combine to form organ systems, and organ systems combine to form organisms.

Explanation:

7 0
3 years ago
Does negative feedback stop or speed up the release of hormones?
DaniilM [7]

Explanation:

Hormone production and release are primarily controlled by negative feedback. In negative feedback systems, a stimulus causes the release of a substance whose effects then inhibit further release. In this way, the concentration of hormones in blood is maintained within a narrow range.

4 0
3 years ago
Need help will give brainlist
WITCHER [35]

Answer:

A. Producer, Consumer, Predator, Decomposer

Explanation:

lol you selected the right answer. Thank you !!

8 0
3 years ago
Read 2 more answers
Other questions:
  • The universe tends to move to a state of entropy or A: disorder B: organization C: mediocrity
    12·3 answers
  • How do sink holes form
    11·1 answer
  • Which class of glycoconjugates contain both d and l-amino acids?
    14·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The absorption of fats differs from that of carbohydrates in that _____.
    13·2 answers
  • Which carbohydrate can be used by the body as an immediate source of energy?
    6·2 answers
  • What is speciation?
    10·2 answers
  • What advantage does having a myelin sheath produced by Schwann cells have for the impulse?
    15·1 answer
  • I’ll mark brainlist
    9·1 answer
  • I need help with this answer
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!