1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mnenie [13.5K]
3 years ago
13

A metabolic pathway which begins with acetyl CoA that causes the reduction of NAD and FAD for ATP production is which of the fol

lowing?
a) Krebs cycle
b) free oxygen radicals
c) chemiosmosis
d) electron transport system
e) glycolysis
Biology
1 answer:
Doss [256]3 years ago
7 0
It is A ( hope this helps)
You might be interested in
a compound made of carbon, hydrogen, and oxygen that living things use for structural purposes and as their main source of energ
Alexeev081 [22]

Answer:

glucose

Explanation:

a compound made up of carbon hydrogen and oxygen that living things use for structural purposes and as their main source of energy is glucose which produce 36 ATP molecule on respiration which is one of the important source of energy and living organism use it for performing their activities

6 0
3 years ago
If two bears can make babies and their babies can also make babies I know they are a
anygoal [31]

Answer:

Explanation:

Салам алейкум

8 0
2 years ago
What is one way that fungus are like plants and one way they are unlike plants?
fiasKO [112]

Like plants, fungi often grow in soil. Unlike plants, Fungi cannot produce their own food. Instead they absorb nutrients from their surroundings.

6 0
3 years ago
Read 2 more answers
Toxicology is used to determine
puteri [66]
I think the answer is c
5 0
3 years ago
Read 2 more answers
What does metabolizing mean?
Troyanec [42]

undergo processing by metabolism.

5 0
3 years ago
Read 2 more answers
Other questions:
  • What is a large membrane bound organelle that contains genetic information and controls the cell's activities?
    8·1 answer
  • Introducing invasive species to an call system results in an increase in biodiversity?
    9·1 answer
  • Are Amino acid <br>A.Nucleic acid<br>B.Protein<br>C.Lipid<br>D.Carbohydrate​
    8·1 answer
  • It is best to say that most human sources of air pollution result from _______.
    11·2 answers
  • Which of the organisms below represents a herbivore?
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Pls help ms draw and label how I am suppose to do the coronal line pls
    5·1 answer
  • ____ is the species that plays an especially important role in its community so that major changes in its numbers affect the pop
    9·1 answer
  • ASAP HELP 100 POINTS Which describes nuclear fission?
    10·2 answers
  • The somatic nervous system controls
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!