1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandr82 [10.1K]
4 years ago
13

Select all that apply

Biology
2 answers:
Arisa [49]4 years ago
7 0
Fitness magazine
please mark as brainliest
vfiekz [6]4 years ago
7 0
A.) Weight-Loss is better Monthly.

In all others, personality of the individual must be maintained, anyone can guess by the name

Hope this helps!
You might be interested in
Plants are to the carbon cycle, as __________ are to the nitrogen cycle
lana66690 [7]

Answer:

Microorganisms.

Explanation:

They break down dead things and release nitrogen back into the soil and atmosphere.

5 0
3 years ago
The goal of all atoms on found on the Periodic Table is to become stable.<br> True<br> False
inysia [295]

Answer:

True

Explanation:

An atom is stable because of a balanced nucleus that does not contain surplus energy. If the forces between the protons and the neutrons in the nucleus are unbalanced, then the atom is unstable. Stable atoms retain their form for ever, while unstable atoms undergo radioactive decay.

6 0
4 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
The graph below shows the long term average monthly temperature of a place which climate zone is the place likely to be found ex
daser333 [38]
What graph!? If u want me to answer that u have to include a graph sooooo ya
8 0
3 years ago
Description of Building the Tree of Life
Leya [2.2K]

Answer:

In this way, the tree of life is a symbol of a fresh start on life, positive energy, good health and a bright future. As a symbol of immortality. A tree grows old, yet it bears seeds that contain its very essence and in this way, the tree becomes immortal. As a symbol of growth and strength.

Explanation:

The Tree of Life symbol represents our personal development, uniqueness and individual beauty. Just as the branches of a tree strengthen and grow upwards to the sky, we too grow stronger, striving for greater knowledge, wisdom and new experiences as we move through life.

7 0
3 years ago
Other questions:
  • How do homologous structures provide evidence for evolution?
    11·1 answer
  • Your carbone footprint is most closely the result of your ?
    6·1 answer
  • What is a measurement of the earths history divided into time periods
    8·2 answers
  • Investigator a conducts research on emphysema using biospecimens from human subjects. the consent form indicates that the resear
    12·1 answer
  • What are the possible consequences of computer piracy?
    13·2 answers
  • Each year, an average person in the United States is exposed to a radiation level of _____.
    14·2 answers
  • Round seeds and yellow seed color are dominant to wrinkled seeds and green seed color. Which Punnett square represents the corre
    8·2 answers
  • The appearance of cyanobacteria in Earth's early history resulted in an excess of oxygen in the atmosphere, which fueled the evo
    9·2 answers
  • One gene has exons lmnop. in nerve cells, the mrna molecules from this gene contain the exons lmn. in muscle cells, the mrna mol
    8·1 answer
  • Which one off this has an effect on gravity Moon<br>Sun<br>Earth<br>Gravity<br>Mass<br>Distance
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!