1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eimsori [14]
3 years ago
12

Cellular is all of the chemical reactions in cells

Biology
1 answer:
murzikaleks [220]3 years ago
5 0

Answer:

(all cells) Sum of all the chemical reactions that take place in the body, consisting of anabolism and catabolism.

Explanation:

You might be interested in
What is the name for the type of white blood cell that produces antibodies that help the body fight infection?
abruzzese [7]
Pathogen(c).....is the answer

4 0
3 years ago
Read 2 more answers
Part of the plant where photosynthesis generally occurs
icang [17]

Answer: Leaves

Explanation:

Photosynthesis takes place in things called chloroplasts. Chloroplasts contain a green substance called chlorophyll. Most of these can be found in the leaves of the plant.

5 0
3 years ago
Read 2 more answers
Six million years ago, hominids had ____________ compared to present-day hominids.
Inessa [10]
I believe the answer is a
7 0
3 years ago
What is a hypothesis?
earnstyle [38]

Answer: D.) a suggested answer to a problem

Explanation:

A hypothesis is a supposition, suggested answer or a proposed explanation based on limited evidence which can be use to start an investigation. A hypothesis is more than a guess but less than a established theory and it can be tested through study and experiments.

<u>A hypothesis is part of the scientific method </u>because it is a prediction which can be tested and the results from those experiments may disprove a hypothesis, but can never entirely prove one.

It is not a conclusion because it is an idea which tries to explain an observation. It is not information collected from experiments because hypothesis are formulated before carrying out the experiments and it is not a widely accepted idea because it just proposes a tentative explanation about a phenomenon.

7 0
3 years ago
Wich of the following is not a necessary step to take before conducting an experiment
zhenek [66]

Answer: A

Explanation: There is no need to conduct and experiment if you already know the answer

7 0
2 years ago
Other questions:
  • Explain briefly why it is important to read good exposition.
    13·2 answers
  • What caused the solar system to form a disk
    13·1 answer
  • Liquids that evaporate quickly are called what?
    14·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Genetic Modification, or Gene Editing, is a type of bioengineering that
    14·1 answer
  • At which stage would one be able to first distinguish a diploblastic embryo from a triploblastic embryo?A) fertilizationB) cleav
    5·1 answer
  • How fast can you answer correct..? How fast can i give you brainliest. Explain Your answer:D/ HELP..............................
    11·2 answers
  • 3. Explain how carbon monoxide acts as a competitive inliibitor on
    7·1 answer
  • Two sisters are born from a father who has blue eyes and a mother who has brown eyes. One sister has blue eyes, and the other ha
    14·2 answers
  • The component molecules of cells have two main parts, the head and the tail. These parts are either hydrophobic or hydrophilic.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!